
Concept explainers
Which of the following cavities would contain your stomach?
a. Peritoneal
b. Pericardial
c. Pleural
d. Thoracic

Introduction:
The space between the parietal peritoneum and visceral peritoneum is called a peritoneal cavity. The peritoneal cavity is filled with peritoneal fluid, which is composed of electrolytes, leukocytes, antibodies and water. This fluid has lubrication and anti-inflammatory properties.
Answer to Problem 1U
Correct answer:
The peritoneal cavity extends from the diaphragm to the floor of the pelvis. It has two divisions; abdominal cavity and pelvic cavity. Therefore, option a. is correct.
Explanation of Solution
Reason for the correct statement:
The peritoneal cavity is a potential space between the parietal peritoneum, which lines the abdominal wall, and the visceral peritoneum, which envelopes the abdominal organs. It is present in the stomach.
Option a. is given as “peritoneal”.
As the “peritoneal cavity surrounds the abdominal organs such as the stomach, liver, gallbladder, pancreas, spleen, kidneys intestine, and ovaries in (female)”, it is the right answer.
Hence, option a. is correct.
Reasons for the incorrect statements:
Option b. is given as “pericardial”.
Pericardial cavities enclose the heart in humans. Therefore, it is a wrong answer.
Option c. is given as “pleural”.
Pleural cavities house the lungs in humans. Therefore, it is a wrong answer.
Option d. is given as “thoracic”.
The thoracic cavity is subdivided into the pleural cavity that houses the lungs, mediastinum that surrounds the thoracic organ, and pericardial cavity that encloses heart. Therefore, it is a wrong answer.
Hence, options b., c., and d. are incorrect.
Conclusion:
The peritoneal cavity is subdivided into; abdominal cavity that contains stomach, liver, gall bladder, spleen, small and large intestine, kidney and ureters, and pelvic cavity that contains bladder, the terminal end of the large intestine and internal reproductive organ.
Want to see more full solutions like this?
Chapter 42 Solutions
Biology
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning


