
To determine:
The hypothetical drug that blocked the receptors for FSH and LH would be useful in men.
Introduction:
The follicle-stimulating hormone (FSH) and luteinizing hormones (LH) are the gonadotropin hormones that are secreted by the anterior lobe of the pituitary gland. They regulate and control the development, puberty, growth, and reproductive events of the body. In both females and males, the FSH and LH stimulate the maturation of the primordial germ cells.

Explanation of Solution
Yes, a hypothetical drug that blocked the receptors for FSH and LH would be useful in males. In human males, the sexual maturation or puberty is marked by the release of Gonadotropin-Releasing Hormone (GnRH) secreted from the hypothalamus. The GnRH triggers the secretion of the LH and FSH from the anterior lobe of the pituitary gland. LH incites the Leydig cells to produce the testosterone, and FSH that works with testosterone to incite spermatogenesis (sperm formation).
So, if a hypothetical drug blocks the receptor for FSH and LH, it will reduce the production of testosterone and the spermatogenesis, which in turn may be used as a potent contraceptive method.
To determine:
The mechanism of action of a hypothetical drug that blocked the receptors for FSH and LH.
Introduction:
FSH receptors are found on the surface of the Sertoli cells and spermatogonia whereas, the LH receptors are found only on the Leydig cells. The activation of the LH receptors stimulates the production of the androgen hormone. The activation of the FSH receptors stimulates the Sertoli cells to produce the testosterone hormone.

Explanation of Solution
The mechanism of action of a drug that blocked the FSH and LH receptor, can be explained by drug-receptor binding mechanism. Drug-receptor binding involves several types of bonds such as ionic, hydrogen, covalent and Van Der Waals force. So, a drug that blocked the receptors of the FSH and LH, will result in the blocking of the sperm formation and testosterone production.
To determine:
The side effects of a drug that blocked the FSH and LH receptors.
Introduction:
The follicle-stimulating hormone (FSH) and luteinizing hormones (LH) are the gonadotropin hormones that are secreted by the anterior lobe of the pituitary gland. FSH receptors are found on the surface of the Sertoli cells and spermatogonia. Whereas, the LH receptors are found only on the Leydig cells.

Explanation of Solution
The side effects of the drug that blocked the FSH and LH receptors are.
The reduction in testosterone would have a feminizing influence on the male body and male libido.
Sexual desire and performance would be greatly reduced.
Hence, if a hypothetical drug blocked the receptor for FSH and LH, it will reduce the production of testosterone and the spermatogenesis. This approach may be used as a potent contraceptive method but it will greatly reduced the sexual desire and performance.
Want to see more full solutions like this?
Chapter 42 Solutions
Biology: Life on Earth with Physiology Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College



