Connect Online Access for Saladin Human Anatomy
Connect Online Access for Saladin Human Anatomy
11th Edition
ISBN: 9781260399738
Author: SALADIN, Kenneth
Publisher: Mcgraw-hill Higher Education (us)
bartleby

Videos

Question
Book Icon
Chapter 4, Problem 4.3.6AYLO
Summary Introduction

To write:

Meaning of teratogens, common categories and their examples.

Introduction:

Teratogens are agents which cause anatomical deformities in the fetus during its development in the uterus. This causes birth defects.

Blurred answer
Students have asked these similar questions
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA  5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

Chapter 4 Solutions

Connect Online Access for Saladin Human Anatomy

Ch. 4.2 - Prob. 9BYGOCh. 4.2 - Prob. 10BYGOCh. 4.2 - Define and describe the neural tube, primitive...Ch. 4.3 - Prob. 1AWYKCh. 4.3 - Prob. 12BYGOCh. 4.3 - Prob. 13BYGOCh. 4.3 - Why is a baby more likely to be born with...Ch. 4 - Prob. 4.1.1AYLOCh. 4 - Prob. 4.1.2AYLOCh. 4 - Prob. 4.1.3AYLOCh. 4 - Prob. 4.1.4AYLOCh. 4 - Prob. 4.1.5AYLOCh. 4 - Prob. 4.1.6AYLOCh. 4 - Prob. 4.1.7AYLOCh. 4 - The duration of pregnancy and how the date of...Ch. 4 - Prob. 4.2.2AYLOCh. 4 - Prob. 4.2.3AYLOCh. 4 - Prob. 4.2.4AYLOCh. 4 - Prob. 4.2.5AYLOCh. 4 - Prob. 4.2.6AYLOCh. 4 - Prob. 4.2.7AYLOCh. 4 - Prob. 4.2.8AYLOCh. 4 - Prob. 4.2.9AYLOCh. 4 - The major changes that occur during the embryonic...Ch. 4 - Prob. 4.2.11AYLOCh. 4 - How the coelom forms, how it divides into the...Ch. 4 - The meaning of organogenesis, and some tissues and...Ch. 4 - Prob. 4.2.14AYLOCh. 4 - Prob. 4.2.15AYLOCh. 4 - Prob. 4.2.16AYLOCh. 4 - Prob. 4.2.17AYLOCh. 4 - Prob. 4.2.18AYLOCh. 4 - Prob. 4.2.19AYLOCh. 4 - The three modes in which the conceptus is...Ch. 4 - The development and mature structure of the...Ch. 4 - The relationship of the placenta to the umbilical...Ch. 4 - Prob. 4.2.23AYLOCh. 4 - The time at which the individual is considered to...Ch. 4 - Prob. 4.2.25AYLOCh. 4 - Prob. 4.3.1AYLOCh. 4 - Prob. 4.3.2AYLOCh. 4 - Prob. 4.3.3AYLOCh. 4 - Prob. 4.3.4AYLOCh. 4 - Prob. 4.3.5AYLOCh. 4 - Prob. 4.3.6AYLOCh. 4 - Prob. 4.3.7AYLOCh. 4 - When a conceptus arrives in the uterus, it is at...Ch. 4 - The entry of a sperm nucleus into an egg must be...Ch. 4 - Prob. 3TYRCh. 4 - Prob. 4TYRCh. 4 - Prob. 5TYRCh. 4 - Prob. 6TYRCh. 4 - Prob. 7TYRCh. 4 - Prob. 8TYRCh. 4 - Prob. 9TYRCh. 4 - For the first 8 weeks of gestation, a conceptus is...Ch. 4 - Viruses and chemicals that cause congenital...Ch. 4 - Prob. 12TYRCh. 4 - Prob. 13TYRCh. 4 - Prob. 14TYRCh. 4 - Prob. 15TYRCh. 4 - The enzymes with which a sperm penetrates an egg...Ch. 4 - Prob. 17TYRCh. 4 - Prob. 18TYRCh. 4 - Prob. 19TYRCh. 4 - Prob. 20TYRCh. 4 - Prob. 1BYMVCh. 4 - Prob. 2BYMVCh. 4 - Prob. 3BYMVCh. 4 - Prob. 4BYMVCh. 4 - Prob. 5BYMVCh. 4 - Prob. 6BYMVCh. 4 - Prob. 7BYMVCh. 4 - Prob. 8BYMVCh. 4 - Prob. 9BYMVCh. 4 - Prob. 10BYMVCh. 4 - Prob. 1WWWTSCh. 4 - Prob. 2WWWTSCh. 4 - Prob. 3WWWTSCh. 4 - Prob. 4WWWTSCh. 4 - Prob. 5WWWTSCh. 4 - Prob. 6WWWTSCh. 4 - Prob. 7WWWTSCh. 4 - Prob. 8WWWTSCh. 4 - Prob. 9WWWTSCh. 4 - Briefly explain why each of the following...Ch. 4 - Only one sperm is needed to fertilize an egg, yet...Ch. 4 - Prob. 2TYCCh. 4 - Prob. 3TYCCh. 4 - Prob. 4TYCCh. 4 - Prob. 5TYC
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
Text book image
Essentials Of Human Development
Biology
ISBN:9781285647357
Author:Kail
Publisher:Cengage
Text book image
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Text book image
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Complications during Labour and Delivery; Author: FirstCry Parenting;https://www.youtube.com/watch?v=QnCviG4GpYg;License: Standard YouTube License, CC-BY