Connect Online Access for Saladin Human Anatomy
11th Edition
ISBN: 9781260399738
Author: SALADIN, Kenneth
Publisher: Mcgraw-hill Higher Education (us)
expand_more
expand_more
format_list_bulleted
Question
Chapter 4, Problem 4.3.6AYLO
Summary Introduction
To write:
Meaning of teratogens, common categories and their examples.
Introduction:
Teratogens are agents which cause anatomical deformities in the fetus during its development in the uterus. This causes birth defects.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
Chapter 4 Solutions
Connect Online Access for Saladin Human Anatomy
Ch. 4.1 - Prob. 1BYGOCh. 4.1 - Prob. 2BYGOCh. 4.1 - Explain the functions of the sperm’s acrosome and...Ch. 4.1 - Describe two ways a fertilized egg prevents the...Ch. 4.2 - List the four primary tissue types of the adult...Ch. 4.2 - Oligohydramnios17 is an abnormally low volume of...Ch. 4.2 - Prob. 5BYGOCh. 4.2 - Prob. 6BYGOCh. 4.2 - Prob. 7BYGOCh. 4.2 - Prob. 8BYGO
Ch. 4.2 - Prob. 9BYGOCh. 4.2 - Prob. 10BYGOCh. 4.2 - Define and describe the neural tube, primitive...Ch. 4.3 - Prob. 1AWYKCh. 4.3 - Prob. 12BYGOCh. 4.3 - Prob. 13BYGOCh. 4.3 - Why is a baby more likely to be born with...Ch. 4 - Prob. 4.1.1AYLOCh. 4 - Prob. 4.1.2AYLOCh. 4 - Prob. 4.1.3AYLOCh. 4 - Prob. 4.1.4AYLOCh. 4 - Prob. 4.1.5AYLOCh. 4 - Prob. 4.1.6AYLOCh. 4 - Prob. 4.1.7AYLOCh. 4 - The duration of pregnancy and how the date of...Ch. 4 - Prob. 4.2.2AYLOCh. 4 - Prob. 4.2.3AYLOCh. 4 - Prob. 4.2.4AYLOCh. 4 - Prob. 4.2.5AYLOCh. 4 - Prob. 4.2.6AYLOCh. 4 - Prob. 4.2.7AYLOCh. 4 - Prob. 4.2.8AYLOCh. 4 - Prob. 4.2.9AYLOCh. 4 - The major changes that occur during the embryonic...Ch. 4 - Prob. 4.2.11AYLOCh. 4 - How the coelom forms, how it divides into the...Ch. 4 - The meaning of organogenesis, and some tissues and...Ch. 4 - Prob. 4.2.14AYLOCh. 4 - Prob. 4.2.15AYLOCh. 4 - Prob. 4.2.16AYLOCh. 4 - Prob. 4.2.17AYLOCh. 4 - Prob. 4.2.18AYLOCh. 4 - Prob. 4.2.19AYLOCh. 4 - The three modes in which the conceptus is...Ch. 4 - The development and mature structure of the...Ch. 4 - The relationship of the placenta to the umbilical...Ch. 4 - Prob. 4.2.23AYLOCh. 4 - The time at which the individual is considered to...Ch. 4 - Prob. 4.2.25AYLOCh. 4 - Prob. 4.3.1AYLOCh. 4 - Prob. 4.3.2AYLOCh. 4 - Prob. 4.3.3AYLOCh. 4 - Prob. 4.3.4AYLOCh. 4 - Prob. 4.3.5AYLOCh. 4 - Prob. 4.3.6AYLOCh. 4 - Prob. 4.3.7AYLOCh. 4 - When a conceptus arrives in the uterus, it is at...Ch. 4 - The entry of a sperm nucleus into an egg must be...Ch. 4 - Prob. 3TYRCh. 4 - Prob. 4TYRCh. 4 - Prob. 5TYRCh. 4 - Prob. 6TYRCh. 4 - Prob. 7TYRCh. 4 - Prob. 8TYRCh. 4 - Prob. 9TYRCh. 4 - For the first 8 weeks of gestation, a conceptus is...Ch. 4 - Viruses and chemicals that cause congenital...Ch. 4 - Prob. 12TYRCh. 4 - Prob. 13TYRCh. 4 - Prob. 14TYRCh. 4 - Prob. 15TYRCh. 4 - The enzymes with which a sperm penetrates an egg...Ch. 4 - Prob. 17TYRCh. 4 - Prob. 18TYRCh. 4 - Prob. 19TYRCh. 4 - Prob. 20TYRCh. 4 - Prob. 1BYMVCh. 4 - Prob. 2BYMVCh. 4 - Prob. 3BYMVCh. 4 - Prob. 4BYMVCh. 4 - Prob. 5BYMVCh. 4 - Prob. 6BYMVCh. 4 - Prob. 7BYMVCh. 4 - Prob. 8BYMVCh. 4 - Prob. 9BYMVCh. 4 - Prob. 10BYMVCh. 4 - Prob. 1WWWTSCh. 4 - Prob. 2WWWTSCh. 4 - Prob. 3WWWTSCh. 4 - Prob. 4WWWTSCh. 4 - Prob. 5WWWTSCh. 4 - Prob. 6WWWTSCh. 4 - Prob. 7WWWTSCh. 4 - Prob. 8WWWTSCh. 4 - Prob. 9WWWTSCh. 4 - Briefly explain why each of the following...Ch. 4 - Only one sperm is needed to fertilize an egg, yet...Ch. 4 - Prob. 2TYCCh. 4 - Prob. 3TYCCh. 4 - Prob. 4TYCCh. 4 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Developmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:CengageHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Complications during Labour and Delivery; Author: FirstCry Parenting;https://www.youtube.com/watch?v=QnCviG4GpYg;License: Standard YouTube License, CC-BY