
EBK HUMAN ANATOMY & PHYSIOLOGY
16th Edition
ISBN: 8220100659836
Author: AMERMAN
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 4, Problem 2AYKA
Summary Introduction
To review:
The effect of scleroderma disease, as in this disease excessive collagen, glycosaminoglycans, and glycoproteins are produced, and are deposited in tissues throughout the body.
Introduction:
The substances thatare present on the outer surface of the cells make the extracellular matrix. It contains collagen, enzymes, glycosaminoglycans, and glycoprotein. It provides structural and biochemical support around cells. This extracellular matrix can be a fluid, a thick gel, or a solid depending upon the tissues.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 4 Solutions
EBK HUMAN ANATOMY & PHYSIOLOGY
Ch. 4.1 - What are the four types of tissues, and what are...Ch. 4.1 - What are the two major components of the ECM, and...Ch. 4.1 - What are the three types of protein fibers?...Ch. 4.1 - Prob. 4QCCh. 4.2 - Why is living epithelial tissue limited to a...Ch. 4.2 - Where is the ECM of epithelial tissue located, and...Ch. 4.2 - What are the three basic shapes of epithelial...Ch. 4.2 - What are the differences between simple,...Ch. 4.2 - Prob. 5QCCh. 4.2 - How do exocrine and endocrine glands differ?
Ch. 4.2 - Compare and contrast merocrine and holocrine...Ch. 4.3 - 1. What are the types of cells of connective...Ch. 4.3 - What is the primary component in: a. loose...Ch. 4.3 - What are the primary differences between brown and...Ch. 4.3 - How do the three types of cartilage differ?Ch. 4.3 - How do bone and blood differ from other connective...Ch. 4.4 - What are the two forms of muscle cells, and how do...Ch. 4.4 - Compare and contrast the three types of muscle...Ch. 4.5 - What are the two main cell types in nervous...Ch. 4.5 - 2. What are the three parts of a neuron, and what...Ch. 4.7 - Where are serous and synovial membranes located,...Ch. 4.7 - 2. Where are mucous membranes located, and what...Ch. 4.7 - 3. What is the cutaneous membrane? What is its...Ch. 4.8 - How do regeneration and fibrosis differ?Ch. 4.8 - Which tissues generally heal by regeneration?...Ch. 4.8 - Which factors influence the ability of a tissue to...Ch. 4 - 1 Which of the following best describes the...Ch. 4 - 2. State whether each of the following describes...Ch. 4 - Describe the roles of each of the following...Ch. 4 - Prob. 4CYRCh. 4 - Mark the following statements as true or false. If...Ch. 4 - 6. Match each type of epithelium with its correct...Ch. 4 - Compare and contrast the following pairs of terms:...Ch. 4 - Explain how connective tissues differ from...Ch. 4 - 9. Mark the following statements as true or...Ch. 4 - 10. Match the following types of connective...Ch. 4 - Which of the following statements about muscle...Ch. 4 - 12. Fill in the blanks: _____are the cells of...Ch. 4 - Prob. 13CYRCh. 4 - Which tissues undergo regeneration? Which tissues...Ch. 4 - 1. If you were to cut through epithelial tissue...Ch. 4 - Prob. 2CYUCh. 4 - Prob. 3CYUCh. 4 - The disease pemphigus vulgaris involves a patients...Ch. 4 - Prob. 2AYKACh. 4 - 3. In the disease pulmonary fibrosis, elastic...Ch. 4 - Imagine that a disease turns the simple epithelia...Ch. 4 - Epithelial cells of the kidneys have pumps that...Ch. 4 - Explain why it would be difficult for a mature...Ch. 4 - 7. Predict which organelles are likely to be...
Knowledge Booster
Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax