The cell theory states that
- a. all living things are composed of cells.
- b. cells are the smallest units of living organisms.
- c. new cells come from pre-existing cells by cell division.
- d. all of the above.
- e. only a and b are true.

Introduction: Cell theory was given by Schleiden and Schwann along with a contribution from Virchow. Organisms existing in nature can either be unicellular or multicellular. Organisms made up of prokaryotic cells are called prokaryotic organisms and organisms made up of eukaryotic cells are called eukaryotic organisms.
Answer to Problem 1TY
Correct answer: Cell theory states that all living things are composed of cells. Cells are the smallest units of living organisms, and new cells arise from pre-existing cells through cell division. Hence, the correct answer is option d.
Explanation of Solution
Reason for correct answer:
The three parts of cell theory are as follows:
- Cells give rise to all living organisms.
- The smallest units of life for all living organisms are cells.
- Pre-existing cells divide to give rise to new cells with the help of cell division.
Option d. is given as “all of the above”.
According to the cell theory, the smallest units of living organisms are cells. All living things are composed of cells and pre-existing cells give rise to a new cell after undergoing cell division. Hence, the correct answer is option d.
Reasons for incorrect answer:
Option a. is given as, “all living things are composed of cells”.
Cell theory states that “all living organisms are composed of cells”. However, it also states that the smallest units of life are cells and new cells are formed when pre-existing cells undergo cell division. Hence, option a. is incorrect.
Option b. is given as, “cells are the smallest units of living organisms”.
Cell theory states that “cells are the smallest units of living organisms”. However, it also states that cells are the basic unit of all living organisms, and cell division gives rise to new cells from pre-existing cells. Hence, option b. is incorrect.
Option c. is given as, “new cells come from pre-existing cells by cell division”.
Cell theory states that the pre-existing cells give rise to new cells after undergoing cell division. However, it also states that cells are the smallest units of life and they give rise to all living organisms. Hence, option c. is incorrect.
Option e. is given as, “only a and b are true”.
Schleiden and Schwann postulated that cells give rise to all living organisms and are the smallest units of life. However, the contributions of Virchow who said that new cells arise from pre-existing cells through cell division is also added to the cell theory. Hence, option e. is incorrect.
Hence, the options a., b., c., and e. are incorrect.
Thus, according to the cell theory, cells are the smallest units of living organisms, all living organisms are made of cells, and pre-existing cells divide to form new cells.
Want to see more full solutions like this?
Chapter 4 Solutions
Biology
Additional Science Textbook Solutions
Laboratory Manual For Human Anatomy & Physiology
General, Organic, and Biological Chemistry: Structures of Life (5th Edition)
Biology: Life on Earth with Physiology (11th Edition)
SEELEY'S ANATOMY+PHYSIOLOGY
Microbiology Fundamentals: A Clinical Approach
Human Physiology: An Integrated Approach (8th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College


