Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 4.4, Problem 2CS
Summary Introduction
To determine: A model of a circular structure formed by SAS -6 proteins and also indicate the proteins that make up this structure.
Introduction: SAS-6 is a key protein that forms an important component of the radial spokes present in axoneme. This protein also determines the nine-fold symmetry as depicted by doublet microtubules. A group of different proteins makes the circular structure of SAS-6 protein.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 4 Solutions
Biology
Ch. 4.1 - What properties of deep-sea vents made them...Ch. 4.1 - Which protobiont seems most similar to todays...Ch. 4.1 - Core Skill: Connections Look back at Figure 3.11....Ch. 4.1 - Prob. 3CCCh. 4.2 - Prob. 1CCCh. 4.2 - Prob. 2CCCh. 4.3 - Prob. 1CSCh. 4.3 - Prob. 1CCCh. 4.3 - Prob. 2CSCh. 4.4 - Prob. 1CS
Ch. 4.4 - Describe the type of movements that occur between...Ch. 4.4 - Prob. 2CSCh. 4.5 - Prob. 1CCCh. 4.5 - Prob. 1CSCh. 4.5 - If we consider the Golgi apparatus as three...Ch. 4.5 - The Nucleus and Endomembrane System Experimental...Ch. 4.5 - Prob. 2EQCh. 4.5 - Prob. 3EQCh. 4.5 - Prob. 3CCCh. 4.6 - Prob. 1CCCh. 4.6 - Core Skill: Connections Look ahead to Figure...Ch. 4.7 - Prob. 1CCCh. 4.7 - Prob. 2CCCh. 4 - The cell theory states that a. all living things...Ch. 4 - Prob. 2TYCh. 4 - Prob. 3TYCh. 4 - Prob. 4TYCh. 4 - Each of the following is part of the endomembrane...Ch. 4 - Prob. 6TYCh. 4 - Functions of the smooth endoplasmic reticulum...Ch. 4 - Prob. 8TYCh. 4 - Prob. 9TYCh. 4 - Which of the following observations would not be...Ch. 4 - What are the four stages that led to the origin of...Ch. 4 - Explain how motor proteins and cytoskeletal...Ch. 4 - Prob. 3CQCh. 4 - Discuss the roles of the genome and proteome in...Ch. 4 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Cell Differentiation | Genetics | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=gwAz_BtVuLA;License: Standard YouTube License, CC-BY