Chapter 4, Problem 1PDT

a.

Summary Introduction

To determine: The primary eight amino acids for each of the given DNA sequences, which are given as follows:

$\begin{array}{l}\text{ATGTCTCTCACCAACAAGAACGTC}\\ \text{ATGgCTCTCACCAACAAGAACGTC}\\ \text{ATGTCgCTCACCAACAAGAACGTC}\\ \text{ATGTCTtTgACCAACAAGAACGTC}\\ \text{ATGTCTCTCACCAACAAGAACGTg}\end{array}$

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

Explanation of Solution

The given DNA sequences are as follows:

$\begin{array}{l}\text{ATGTCTCTCACCAACAAGAACGTC}\\ \text{ATGgCTCTCACCAACAAGAACGTC}\\ \text{ATGTCgCTCACCAACAAGAACGTC}\\ \text{ATGTCTtTgACCAACAAGAACGTC}\\ \text{ATGTCTCTCACCAACAAGAACGTg}\end{array}$

The amino acids from the above DNA sequences using the codon table are given below:

$\begin{array}{c}\text{MetSerLeuThrAsnLysAsnVal }\\ \text{MetAlaLeuThrAsnLysAsnVal }\\ \text{MetSerLeuThrAsnLysAsnVal}\\ \text{MetSerLeuThrAsnLysAsnVal}\\ \text{MetSerLeuThrAsnLysAsnVal}\end{array}$

b.

Summary Introduction

To determine: The five polymorphic sites and signify whether the site is represented by synonymous or non-synonymous polymorphisms in the given DNA sequences.

$\begin{array}{l}\text{ATGTCTCTCACCAACAAGAACGTC}\\ \text{ATGgCTCTCACCAACAAGAACGTC}\\ \text{ATGTCgCTCACCAACAAGAACGTC}\\ \text{ATGTCTtTgACCAACAAGAACGTC}\\ \text{ATGTCTCTCACCAACAAGAACGTg}\end{array}$

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

Explanation of Solution

The process of polymorphism results in the modification of the nucleotide. The “synonymous polymorphism” is defined as the production of the same type of amino acid after the modification in the nucleotide.

The synonymous or non-synonymous polymorphisms in sequences are as follows:

$\begin{array}{c}\text{MetSerLeuThrAsnLysAsnVal - Synonymous}\\ \text{MetAlaLeuThrAsnLysAsnVal - Non-synonymous }\\ \text{MetSerLeuThrAsnLysAsnVal - Synonymous}\\ \text{MetSerLeuThrAsnLysAsnVal - Synonymous}\\ \text{MetSerLeuThrAsnLysAsnVal - Synonymous}\end{array}$

The production of “alanine” in the second sequence fulfills the criteria of polymorphism.

c.

Summary Introduction

To determine: The one-difference intermediate in the production of TTG from CTC.

$\begin{array}{l}\text{ATGTCTCTCACCAACAAGAACGTC}\\ \text{ATGgCTCTCACCAACAAGAACGTC}\\ \text{ATGTCgCTCACCAACAAGAACGTC}\\ \text{ATGTCTtTgACCAACAAGAACGTC}\\ \text{ATGTCTCTCACCAACAAGAACGTg}\end{array}$

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

Explanation of Solution

According to the provided information, the CTC sequence is responsible for the production of TTG sequence. Both the codons code for “Leu.” However, the codon that could be the intermediate of the process could be the same as “leu.” TTC codes for the “Phe” when activated; hence, it cannot be the intermediate in the reaction. Hence, the one-difference intermediate must be CTG, which also codes for the “Leu” that forms the bridge in the production of TTG from the CTC codon.

d.

Summary Introduction

To determine: The reason that synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

$\begin{array}{l}\text{ATGTCTCTCACCAACAAGAACGTC}\\ \text{ATGgCTCTCACCAACAAGAACGTC}\\ \text{ATGTCgCTCACCAACAAGAACGTC}\\ \text{ATGTCTtTgACCAACAAGAACGTC}\\ \text{ATGTCTCTCACCAACAAGAACGTg}\end{array}$

Introduction: The given DNA sequences encode the initial eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that vary from the first sequence are shown by a lowercase letter. The sequences of DNA code for a number of alleles. The alleles are responsible for specific assignation of characters to the individual. There are a number of alleles that can be present within a gene. The genes are present in the chromosomes, and the chromosomes are present in pairs. Alleles are responsible for the genotypic character of the organism, which reflects in the phenotype of the organism.

Explanation of Solution

There is a repetition of “3-letter codes” along the codon for the coding of specific amino acid. The production of new amino acid takes place when there is a change in the second element, resulting in non-synonymous polymorphism. However, changes in the third element of the codon give the similar amino acid. Thus, synonymous polymorphisms are likely to be more frequent than non-synonymous polymorphisms.

$\begin{array}{c}\text{MetSerLeuThrAsnLysAsnVal - Synonymous}\\ \text{MetAlaLeuThrAsnLysAsnVal - Non-synonymous }\\ \text{MetSerLeuThrAsnLysAsnVal - Synonymous}\\ \text{MetSerLeuThrAsnLysAsnVal - Synonymous}\\ \text{MetSerLeuThrAsnLysAsnVal - Synonymous}\end{array}$