
Introduction: Plant hormones are chemical molecules produced by plants in extremely low concentration for regulating the growth and development. There are five major hormones involved in the growth process. They are auxin, gibberellin, ethylene, abscisic acid, and cytokinin. Each of these hormones has its own functions at specific locations. The presence of these hormones in a definite amount is very essential for the normal growth and development of the plant.

Answer to Problem 1TYU
Correct answer: In the signal transduction process for the hormone auxin, the molecule ubiquitin tags certain proteins for destruction.
Hence, the correct answer is option (c).
Explanation of Solution
Reason for the correct answer:
General mechanism of action of auxin hormone:
Auxins are a group of related hormones responsible for a wide range of consequences on the growth and development of plants. Within a certain concentration, Auxin stimulates cell elongation in stems and coleoptiles. Auxin inhibits elongation growth by increasing the cell wall extensibility, according to the acid growth hypothesis. The main effects of auxin are to promote cell elongation according to the concentration.
Many plant hormones bind to the receptors which trigger the enzymatic reaction and results in the changes for cell growth and development of the plants. Both external and internal signal triggers the auxin hormone synthesis. The cytosol or the nucleus of the cell contains one receptor with three-dimensional shape (TIR1 receptor) that binds to auxin molecule. As the auxin binds to its receptor, ubiquitin molecule attaches to the repressor molecule and inhibits the auxin response genes. Thereafter, the ubiquitinylated protein is targeted and degraded into peptide fragments in a proteasome. This causes transcription of auxin response gene which acidifies the cell wall of target cells. The acidified target cell walls become more plastic which enables it to expand due to increased force of the cell’s turgor pressure. Thus, the action of auxin hormone causes cell expansion without cell division.
Option (c) is given as “tags certain proteins for destruction”.
The small regulatory protein called ubiquitin attaches to other proteins and are used to tag certain proteins for destruction. This process of tagging is referred to as ubiquitination and it is a post-translational modification. Ubiquitin-mediated proteolysis normally takes place during auxin signaling in plants.
Hence, the correct answer is option (c).
Reasons for the incorrect answers:
Option (a) is given as “absorbs blue light”.
Phototropins are the proteins that absorb blue light and they help to control the photosynthetic efficacy of plants, not auxins.
Hence, option (a) is incorrect.
Option (b) is given as “becomes phosphorylated”.
Phototropins are the blue-light receptors that control the photosynthetic efficacy of plants located at the shoot tips. These proteins become phosphorylated in response to blue light.
Hence, option (b) is incorrect.
Option (d) is given as “interacts antagonistically with gibberellins”.
Gibberellin is a growth-regulating hormone that enhances the elongation of stems and leaves and in the development of fruits. During auxin signaling in plants, the ubiquitin molecule does not antagonistically interact with gibberellins. Instead, ubiquitin-mediated proteolysis takes place in the signal transduction process in auxin.
Hence, option (d) is incorrect.
Option (e) is given as “binds to a receptor in the plant cell’s plasma membrane”.
During auxin signaling in plants, the ubiquitin molecule does not bind to a receptor in the plasma membrane of the plant cell. Instead, ubiquitin-mediated proteolysis takes place in the signal transduction process in auxin.
Hence, option (e) is incorrect.
Hence, options (a), (b), (d), and (e) are incorrect.
As the auxin binds to its receptor, ubiquitin molecule attaches to the repressor molecule in order to target it for destruction.
Want to see more full solutions like this?
Chapter 38 Solutions
Biology (MindTap Course List)
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning




