
A student rescan, her decides to perform an experiment on the effect of the thyroid gland on frog metamorphosis. She sets up three aquaria with tadpoles. She adds thyroxine to the water of one, the drug thiouracil to a second, and nothing to the third. Thiouracil destroys thyroxine. Assuming that the student uses appropriate concentrations, predict what will happen.

To predict:
The things that might happen to three sets of tadpoles when the first set is grown in presence of thyroxine, the second set is grown in presence of thiouracil, and third is grown in normal water.
Introduction:
In the given scenario, a researcher wants to conduct an experiment on the effect of the thyroid gland in metamorphosis in the frog. For her experiment, she sets up three aquaria. In the first aquarium, she added thyroxine. In the second aquarium she added thiouracil and in the third nothing was added.
Explanation of Solution
The metamorphosis can be defined as the process through which the newborn animal physically develops into an adult by undergoing several changes. It is the feature of all the chordates and is induced by iodothyronine.
Thyroxine induces metamorphosis in the frog. In the aquarium in which thyroxine was added; the tadpoles will metamorphose into frog earlier than the normal tadpoles. Thiouracil destroys the thyroxine, thereby inhibiting the metamorphosis. So the tadpoles growing in the aquarium containing thiouracil will not show metamorphosis.
The thyroid gland of tadpoles produces a normal amount of thyroxine, which is sufficient to induce metamorphosis. So the tadpoles growing in the aquarium containing normal water will metamorphose at a normal rate.
The tadpoles growing in normal water will undergo metamorphosis at a normal rate, the tadpoles grown in presence of thyroxine will have metamorphosis earlier than normal. The tadpoles grown in presence of thiouracil will not undergo metamorphosis as it would be inhibited by thiouracil.
Want to see more full solutions like this?
Chapter 38 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Additional Science Textbook Solutions
Genetics: From Genes to Genomes
Biological Science (6th Edition)
Campbell Essential Biology (7th Edition)
Campbell Biology in Focus (2nd Edition)
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageUnderstanding Nutrition (MindTap Course List)Health & NutritionISBN:9781337392693Author:Eleanor Noss Whitney, Sharon Rady RolfesPublisher:Cengage Learning


