
BIO 102 General Biology II Updated Edition (Tidewater Community College)
3rd Edition
ISBN: 9781259614064
Author: Tidewater Community College
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Question
Chapter 37.6, Problem 2MC
Summary Introduction
To explain:
The reason behind the production of smaller offspring by mollies in the light and non-toxic streams in comparison to the larger offspring by mollies in dark, toxic streams.
Concept introduction:
The life history traits are affected by the harsh environments. An ideal example for studying the life in a challenging environment is of Atlantic mollies (Poecilia mexicana). There are four different habitats for the mollies. The first kind of habitat is the light, non-toxic water second is light toxic water, third type of habitat is the dark non-toxic water and fourth type of habitat is dark, toxic water.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 37 Solutions
BIO 102 General Biology II Updated Edition (Tidewater Community College)
Ch. 37.1 - Define population, community, and ecosystem.Ch. 37.1 - What is population density?Ch. 37.1 - Distinguish among the types of distribution in a...Ch. 37.1 - Prob. 4MCCh. 37.2 - Prob. 1MCCh. 37.2 - Prob. 2MCCh. 37.2 - Prob. 3MCCh. 37.2 - Prob. 4MCCh. 37.3 - Prob. 1MCCh. 37.3 - Prob. 2MC
Ch. 37.3 - Prob. 3MCCh. 37.3 - Prob. 4MCCh. 37.3 - Prob. 5MCCh. 37.4 - Prob. 1MCCh. 37.4 - Distinguish between opportunistic and equilibrium...Ch. 37.5 - Which parts of the world have the highest and...Ch. 37.5 - How does the demographic transition reflect...Ch. 37.5 - Prob. 3MCCh. 37.5 - What are some of the environmental consequences of...Ch. 37.6 - Prob. 1MCCh. 37.6 - Prob. 2MCCh. 37 - Population size increases when a. the sum of birth...Ch. 37 - 2. A population that has a high level of parental...Ch. 37 - Prob. 3MCQCh. 37 - Prob. 4MCQCh. 37 - Prob. 5MCQCh. 37 - Prob. 1WIOCh. 37 - Prob. 2WIOCh. 37 - Describe the difference between population density...Ch. 37 - Why might an ecologist be interested in studying...Ch. 37 - Calculate the anticipated size of the rotifer...Ch. 37 - Prob. 6WIOCh. 37 - Prob. 7WIOCh. 37 - Prob. 8WIOCh. 37 - Prob. 9WIOCh. 37 - Prob. 10WIOCh. 37 - Prob. 11WIOCh. 37 - Prob. 12WIOCh. 37 - Prob. 13WIOCh. 37 - Prob. 14WIOCh. 37 - Prob. 15WIOCh. 37 - Prob. 1PITCh. 37 - 3. Add the following terms to this concept map:...Ch. 37 - Prob. 3PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College


Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
5 Human Impacts on the Environment: Crash Course Ecology #10; Author: CrashCourse;https://www.youtube.com/watch?v=5eTCZ9L834s;License: Standard YouTube License, CC-BY
Aquatic Ecosystems; Author: Ocean Research & Conservation Association (ORCA);https://www.youtube.com/watch?v=4tU08jCvwGg;License: Standard YouTube License, CC-BY
Aquatic Ecosystems; Author: David Akerman;https://www.youtube.com/watch?v=9T6Q2I_kPeo;License: Standard Youtube License