
Concept explainers
Which of the following is an active transport mechanism?
a. Proton pump
b. Ion channel
c. Symport
d. Osmosis

Introduction:
Active transport mechanism is the transport method that requires energy to move the particles against the concentration gradient.
Answer to Problem 1U
Correct answer:
Proton pump is a type of active transport mechanism that requires energy to transfer proton against the concentration gradient. Therefore, option a. is correct.
Explanation of Solution
Reason for correct statement:
The transfer of the protons from a lower concentration to a higher concentration is done with the help of the energy molecules. The process of utilization of ATP molecules for the transfer of the protons against the concentration gradient is known as proton pump.
Option a. is given as “Proton pump”.
As, “the proton pump is a type of the active transport mechanism that requires energy for the transfer of the protons between the layers,” is the right answer.
Hence, the option a. is correct.
Reasons for the incorrect statements:
Option b. is given as “ion channel”.
The transportation of ions from higher concentration towards lower concentration is done through the help of the ion channels. So, it is a wrong answer.
Option c. is given as “symport”.
The transport of two or more molecules together across the membrane is known as symport. So, it is a wrong answer.
Option d. is given as “osmosis”.
The process in which solvent moves from the semi permeable membrane form lower concentration to higher concentration is known as osmosis. So, it is a wrong answer.
Hence, options b, c, and d are incorrect.
Active transport mechanism requires the energy produced by the cell for the transport of the molecules against the concentration gradient.
Want to see more full solutions like this?
Chapter 37 Solutions
Biology
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning



