Campbell Biology in Focus, Books a la Carte Edition; Modified Mastering Biology with Pearson eText - ValuePack Access Card - for Campbell Biology in Focus (2nd Edition)
2nd Edition
ISBN: 9780134433769
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 3.6, Problem 2CC
Summary Introduction
To draw:
The complementary strand of a DNA sequence that has the nitrogenous bases as
Concept introduction:
Macromolecules are the compounds that include the proteins, carbohydrates and the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’
The following strand of DNA is transcribed:
5'-GACCTCCGAATGC-3'
Write the sequence of the resulting product from 5' to 3'. Only write the symbols for the bases; do not write "5'-" and "-3'" in your sequence.
Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'
Chapter 3 Solutions
Campbell Biology in Focus, Books a la Carte Edition; Modified Mastering Biology with Pearson eText - ValuePack Access Card - for Campbell Biology in Focus (2nd Edition)
Ch. 3.1 - How are gasoline and fat chemically similar?Ch. 3.1 - Which molecules in Figure 3.4a re isomers? For...Ch. 3.1 - Prob. 3CCCh. 3.1 - Prob. 4CCCh. 3.2 - How many molecules of water are needed to...Ch. 3.2 - WHAT IF? Suppose you eat a serving of fish. What...Ch. 3.3 - Write the formula for a monosaccharide that has...Ch. 3.3 - A dehydration reaction joins two glucose molecules...Ch. 3.3 - WHAT IF? After a cow is given antibiotics to treat...Ch. 3.4 - Compare the structure of a fat (triglyceride) with...
Ch. 3.4 - Why are human sex hormones considered lipids?Ch. 3.4 - Prob. 3CCCh. 3.5 - Why does a denatured protein no longer function...Ch. 3.5 - What parts of a polypeptide participate in the...Ch. 3.5 - WHAT IF? Where would you expect a polypeptide...Ch. 3.6 - DRAW IT Go to Figure 3.27a and, for the top three...Ch. 3.6 - Prob. 2CCCh. 3.7 - How would sequencing the entire genome of an...Ch. 3.7 - Given the function of DNA, why would you expect...Ch. 3 - Prob. 1TYUCh. 3 - Which functional group is not present in this...Ch. 3 - MAKE CONNECTIONS Which chemical group is most...Ch. 3 - Prob. 4TYUCh. 3 - Which of the following statements concerning...Ch. 3 - The structural level of a protein least a fleeted...Ch. 3 - Enzymes that break down DNA catalyze the...Ch. 3 - Prob. 8TYUCh. 3 - The molecular formula for glucose is C6H12O6. What...Ch. 3 - Construct a table that organizes the following...Ch. 3 - Prob. 11TYUCh. 3 - Prob. 12TYUCh. 3 - FOCUS ON ORGANIZATION Proteins, which have diverse...Ch. 3 - Prob. 14TYUCh. 3 - SYNTHESIZE YOUR KNOWLEDGE Given that the function...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixarrow_forwardMake the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:arrow_forwardDNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?arrow_forward
- How many kilobases of the DNA strand below will code for the protein product?arrow_forwardDescribe the structure and complementary base pairing of DNA.arrow_forwardThe DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?arrow_forward
- In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:arrow_forwardOne nucleotide strand of a DNA molecule has the base sequence illustrated below. 5′ –ATTGCTACGG–3′ Give the base sequence and label the 5′ and 3′ ends of the complementary DNA nucleotide strand.arrow_forwardWhat is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.arrow_forward
- The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.arrow_forwardList the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-Garrow_forwardDraw a 4-N base strand of DNA with all four N-base sequences representedarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license