
A.
To determine: The pathogenesis of the women’s symptom, related to myasthenia gravis.
Introduction: The myasthenia gravis is an autoimmune disorder of neuromuscular junction, which affects the transmission of impulse between the muscle cells and motor neuron. The women are mostly affected by this disorder during adulthood.
A.

Explanation of Solution
Myasthenia gravis is caused by the antibody-mediated loss of the acetylcholine receptors in the neuromuscular. There is three mechanism which leads to loss of the functional acetylcholine receptors: complement-mediated injury of the postsynaptic muscle membrane, degradation of the acetylcholine receptors by the receptor-specific antibodies and the blockage of the receptors due to attachment of the antibodies. The disorder affects the motor response, which results in muscle weakness. The eye and periorbital muscles are mostly affected, along with drooping of the eye due to eyelid weakness.
B.
To determine: The use of information from the administration of the acetylcholinesterase inhibitor edrophonium to assist in the diagnosis of the disorder.
Introduction: The myasthenia gravis is often appeared in women during their early adulthood and is higher in men after the age of 50. The disorder can also transfer through the placenta to the fetus and cause neonatal myasthenia. The symptoms involve diplopia, ptosis, weakness of extraocular muscles, difficulty in chewing and swallowing and many more.
B.

Explanation of Solution
The diagnosis of Myasthenia gravis is confirmed aft6er the history and physical examination by a simple test known as short-acting anticholinesterase test. The Endrophonium or Tensilon is commonly used in the test. Tensilon is a drug which decreases the breakdown of acetylcholine in the neuromuscular junction. The electrophysiologic studies can also be done to examine the muscle response to repetitive motor nerve stimulation. The treatment includes the use of immunosuppressive therapy, corticosteroid drugs, thymectomy, and plasmapheresis.
Want to see more full solutions like this?
Chapter 36 Solutions
Essentials of Pathophysiology: Concepts of Altered States
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





