
Concept explainers
Introduction:
Excretion is the removal of waste from the body through the urinary system. Animal’s lifestyle is responsible for the type of nitrogenous waste in the form of excretion.

Answer to Problem 1MC
Correct answer:
Freshwater organisms excrete their feces in the form of ammonia. Therefore, option (a) is correct.
Option (a) is given as “Freshwater organisms are likely to excrete ammonia”.
Explanation of Solution
Justify reason for the correct statement:
Aquatic animals do not possess specific urinary system. They tend to excrete through gills and skin. So they are bound to excrete in the form of gas. Ammonia is the simplest form of nitrogenous waste in the form of gas.
Hence, option (a) is correct.
Justify reasons for the incorrect statements:
Option (b) is given as “ammonia is mostly excreted in urine”. Ammonia is a gas and urine contain water; additionally, the nitrogenous waste in urine is urea. Hence, it is a wrong answer.
Option (c) is given as “ammonia is the most complex of the three major nitrogenous wastes”. Ammonia is the simplest form of nitrogenous waste, urea is the most complex nitrogenous waste. Hence, it is a wrong answer.
Option (d) is given as “Humans convert ammonia to urea in the kidney”.
Conversion of ammonia into urea takes place inside the human body and this is called as urea cycle, but the site of the cycle is not the kidney, it is the liver. Hence, it is a wrong answer.
Hence, options (b), (c), and (d) are incorrect.
Ammonia is a gaseous form of nitrogenous waste. It is the simplest form, produced due to break down of amino acids in the human body. The liver performs the urea cycle to convert the ammonia into urea.
Want to see more full solutions like this?
Chapter 36 Solutions
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Cardiopulmonary Anatomy & PhysiologyBiologyISBN:9781337794909Author:Des Jardins, Terry.Publisher:Cengage Learning,



