Concept explainers
To determine: The three types of lymphocytes and the three types of phagocytes.
Introduction: The cells that are responsible for adaptive immunity are known as lymphocytes. There are three types of lymphocytes. However, the immune cells that attack the pathogens by the process of phagocytosis are called phagocytes. They engulf the attacking pathogens and kill them.

Explanation of Solution
The three types of lymphocytes are as follows:
- B lymphocytes:
B-cell lymphocytes are the cells that have to differentiate into other types of cells called plasma cells. These plasma cells are able to destroy an antigen. The primary function of the B cells is to produce humoral immune responses, antibodies, and memory cells.
- T lymphocytes:
There are two types of T lymphocytes. These are helper T cells and cytotoxic T cells. The cytotoxic T-cells are the cells that require activation molecules such as an antigen to kill antigens. The function of the cytotoxic T cells is to generate cellular responses. However, helpers T-cells are the cells that enhance the activity of both B and cytotoxic T-cells. The function of the helper T cells is to regulate the humoral and cellular responses.
- Natural Killers (NK):
Natural killers (NK cells) are a type of lymphocytes that kill the pathogens by releasing harmful toxins and chemicals. They attack the body parts that are infected by viruses.
The three types of phagocytes are as follows:
- Macrophages:
These are the phagocyte cells that engulf the invading pathogens and kill them by the process of phagocytosis. They also help in the process of antigen presentation.
- Dendritic cells:
The dendritic cells are the phagocytes that function very similarly to the macrophages. The dendritic cells engulf the pathogens and kill them by the process of phagocytosis. They present the antigens to the T cells.
- Neutrophils:
They are the phagocytes that are involved in the process of inflammation. They destroy the microorganisms that are present in the areas that are affected by inflammation.
Want to see more full solutions like this?
Chapter 36 Solutions
PRINCIPLES OF LIFE W ACHIEVE
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





