
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
12th Edition
ISBN: 9780135755785
Author: Gerald Audesirk, Teresa Audesirk
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Question
Chapter 33.2, Problem 2CYL
Summary Introduction
To determine:
The flow of blood through a four-chambered heart, and also name the structures through which the blood passes with function.
Introduction:
The heart is the muscular organ present in most of the animals. The heart will act as a pump that circulates the blood. The heart has four chambers. Mammals have four chambers heart that has two ventricles and two atria in four chamber heart two separate pumps are present, which helps in maintaining the pressure and prevent mixing of oxygenated and deoxygenated blood.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 33 Solutions
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
Ch. 33.1 - Why doesnt insect hemolymph need hemoglobin?Ch. 33.1 - Prob. 1CYLCh. 33.1 - compare open and closed circulatory systems?Ch. 33.1 - describe the functions of the vertebrate...Ch. 33.2 - Prob. 1CSCCh. 33.2 - Prob. 1TCCh. 33.2 - Prob. 1HYEWCh. 33.2 - describe the three types of vertebrate hearts and...Ch. 33.2 - Prob. 2CYLCh. 33.2 - Prob. 3CYL
Ch. 33.3 - Prob. 1TCCh. 33.3 - Prob. 2TCCh. 33.3 - describe each component of blood and explain its...Ch. 33.3 - Prob. 2CYLCh. 33.3 - explain the sequence of events during blood...Ch. 33.4 - Prob. 1TCCh. 33.4 - Prob. 2TCCh. 33.4 - Prob. 1CYLCh. 33.4 - Prob. 2CYLCh. 33.4 - Prob. 3CYLCh. 33.5 - Prob. 1TCCh. 33.5 - Prob. 1CSCCh. 33.5 - Prob. 1CYLCh. 33.5 - Prob. 2CYLCh. 33.5 - Prob. 3CYLCh. 33 - Prob. 1MCCh. 33 - Which of the following is True? a. Arteriole...Ch. 33 - Prob. 3MCCh. 33 - Prob. 4MCCh. 33 - Which of the following is true of blood pressure?...Ch. 33 - Prob. 1FIBCh. 33 - Prob. 2FIBCh. 33 - The hearts pacemaker is called the (complete term)...Ch. 33 - Prob. 4FIBCh. 33 - Prob. 5FIBCh. 33 - Prob. 6FIBCh. 33 - Lymph is ___________ that has entered lymphatic...Ch. 33 - List the major structures of all circulatory...Ch. 33 - Describe and compare the features of open and...Ch. 33 - Explain how two- and three-chambered vertebrate...Ch. 33 - Prob. 4RQCh. 33 - Prob. 5RQCh. 33 - Prob. 6RQCh. 33 - Prob. 7RQCh. 33 - Prob. 8RQCh. 33 - Describe the cardiac cycle, and relate the...Ch. 33 - Prob. 10RQCh. 33 - Prob. 11RQCh. 33 - Prob. 12RQCh. 33 - In what way do veins and lymphatic vessels...Ch. 33 - Prob. 1ACCh. 33 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
The Cardiovascular System: An Overview; Author: Strong Medicine;https://www.youtube.com/watch?v=Wu18mpI_62s;License: Standard youtube license