The negative feedback system regulates the number of red blood cells. Introduction: Reduced oxygen level in the liver and kidneys releases erythropoietin and stimulates the production of red blood cells. Red blood cell production is regulated by negative feed mechanism, and within few days new red blood cells are produced and circulated in blood.

Question

Want to see the full answer?

Answer 1

Question

Chapter 33, Problem 12RQ

Summary Introduction

To describe:

The negative feedback system regulates the number of red blood cells.

Introduction:

Reduced oxygen level in the liver and kidneys releases erythropoietin and stimulates the production of red blood cells. Red blood cell production is regulated by negative feed mechanism, and within few days new red blood cells are produced and circulated in blood.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?

Answer 2

Question

Chapter 33, Problem 12RQ

Summary Introduction

To describe:

The negative feedback system regulates the number of red blood cells.

Introduction:

Reduced oxygen level in the liver and kidneys releases erythropoietin and stimulates the production of red blood cells. Red blood cell production is regulated by negative feed mechanism, and within few days new red blood cells are produced and circulated in blood.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 33, Problem 12RQ

Summary Introduction

To describe:

The negative feedback system regulates the number of red blood cells.

Introduction:

Reduced oxygen level in the liver and kidneys releases erythropoietin and stimulates the production of red blood cells. Red blood cell production is regulated by negative feed mechanism, and within few days new red blood cells are produced and circulated in blood.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 33, Problem 12RQ

Summary Introduction

To describe:

The negative feedback system regulates the number of red blood cells.

Introduction:

Reduced oxygen level in the liver and kidneys releases erythropoietin and stimulates the production of red blood cells. Red blood cell production is regulated by negative feed mechanism, and within few days new red blood cells are produced and circulated in blood.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 33, Problem 12RQ

Summary Introduction

To describe:

The negative feedback system regulates the number of red blood cells.

Introduction:

Reduced oxygen level in the liver and kidneys releases erythropoietin and stimulates the production of red blood cells. Red blood cell production is regulated by negative feed mechanism, and within few days new red blood cells are produced and circulated in blood.

Answer 6

Chapter 33, Problem 12RQ

Summary Introduction

To describe:

The negative feedback system regulates the number of red blood cells.

Introduction:

Reduced oxygen level in the liver and kidneys releases erythropoietin and stimulates the production of red blood cells. Red blood cell production is regulated by negative feed mechanism, and within few days new red blood cells are produced and circulated in blood.

Answer 7

Chapter 33, Problem 12RQ

Summary Introduction

To describe:

The negative feedback system regulates the number of red blood cells.

Introduction:

Reduced oxygen level in the liver and kidneys releases erythropoietin and stimulates the production of red blood cells. Red blood cell production is regulated by negative feed mechanism, and within few days new red blood cells are produced and circulated in blood.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 33.1 - Why doesnt insect hemolymph need hemoglobin?Ch. 33.1 - Prob. 1CYL Ch. 33.1 - compare open and closed circulatory systems?Ch. 33.1 - describe the functions of the vertebrate...Ch. 33.2 - Prob. 1CSC Ch. 33.2 - Prob. 1TC Ch. 33.2 - Prob. 1HYEW Ch. 33.2 - describe the three types of vertebrate hearts and...Ch. 33.2 - Prob. 2CYL Ch. 33.2 - Prob. 3CYL

Solution Summary: The author describes the negative feedback system, which regulates the number of red blood cells in the body.

Concept explainers

Want to see the full answer?

Chapter 33 Solutions