
Biology
12th Edition
ISBN: 9781260494570
Author: Raven, Peter
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 33, Problem 5U
Summary Introduction
Introduction:
All the animals, considered as annelids, contain segmentation in their body. The segments are ringlike that are separated by septa in the body of annelids. These segments involve a pair of excretory organs, a ganglion and a set of reproductive organs (marine annelids). Annelids contain anterior and posterior segments that are light, chemo and a touch receptor. Each segment is connected through a ventral nerve.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 33 Solutions
Biology
Ch. 33.1 - Prob. 1LOCh. 33.2 - Prob. 1LOCh. 33.2 - Prob. 2LOCh. 33.3 - Prob. 1LOCh. 33.4 - Prob. 1LOCh. 33.4 - Prob. 2LOCh. 33.4 - Prob. 3LOCh. 33.5 - Prob. 1LOCh. 33.6 - Prob. 1LOCh. 33.6 - Distinguish between the Errantia and Sedentaria.
Ch. 33.6 - Describe adaptations in leeches for feeding on the...Ch. 33.7 - Prob. 1LOCh. 33.7 - Prob. 2LOCh. 33.8 - Prob. 1LOCh. 33.8 - Prob. 2LOCh. 33.9 - Prob. 1LOCh. 33.9 - Prob. 2LOCh. 33.9 - Prob. 3LOCh. 33 - In the flatworm, flame cells are involved in what...Ch. 33 - Prob. 2UCh. 33 - Prob. 3UCh. 33 - Prob. 4UCh. 33 - Prob. 5UCh. 33 - Prob. 6UCh. 33 - Prob. 7UCh. 33 - Prob. 8UCh. 33 - Prob. 9UCh. 33 - Prob. 10UCh. 33 - Examples of decapods are a. centipedes and...Ch. 33 - Prob. 1ACh. 33 - Prob. 2ACh. 33 - Prob. 3ACh. 33 - Scientists studying the Chesapeake Bay have...Ch. 33 - Chitin is present in a number of invertebrates, as...Ch. 33 - Prob. 3SCh. 33 - Prob. 4S
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College


Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax