
EBK BIOLOGY
11th Edition
ISBN: 8220106820636
Author: Martin
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 32.8, Problem 11LO
Summary Introduction
To describe: The five key characters of mammals and to contrast the protherian, metatherian, and eutherian mammals accordingly with examples of animals that belong to each group.
Concept introduction: In the late Devonian era, the aquatic vertebrates evolved to form terrestrial animals. This adaptation is an important step towards the evolution of modern terrestrial vertebrates. By the end of Cretaceous era, the mammals had evolved from amniotic ancestors.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 32 Solutions
EBK BIOLOGY
Ch. 32.1 - Prob. 1LOCh. 32.1 - Prob. 1CCh. 32.2 - Identify three shared derived characters of...Ch. 32.2 - Prob. 1CCh. 32.2 - Prob. 2CCh. 32.3 - Describe characteristics of chordates, including...Ch. 32.3 - What are four shared derived characters of...Ch. 32.3 - Prob. 2CCh. 32.3 - Prob. 3CCh. 32.4 - Prob. 4LO
Ch. 32.4 - Prob. 1CCh. 32.4 - If you found a small fishlike animal along the...Ch. 32.5 - Prob. 5LOCh. 32.5 - Prob. 6LOCh. 32.5 - Prob. 1CCh. 32.5 - Prob. 2CCh. 32.6 - Prob. 7LOCh. 32.6 - Prob. 1CCh. 32.7 - Prob. 8LOCh. 32.7 - Prob. 1CCh. 32.7 - Prob. 2CCh. 32.8 - Describe three vertebrate adaptations to...Ch. 32.8 - Prob. 10LOCh. 32.8 - Prob. 11LOCh. 32.8 - Prob. 1CCh. 32.8 - Prob. 2CCh. 32.8 - Prob. 3CCh. 32.8 - Prob. 4CCh. 32 - Test Your Understanding 1.Which of the following...Ch. 32 - Test Your Understanding 2.Which of the following...Ch. 32 - Test Your Understanding 3.A shark is characterized...Ch. 32 - Test Your Understanding 4.Which of the following...Ch. 32 - Test Your Understanding 5.Reptiles (a) are all...Ch. 32 - Test Your Understanding 6.Which of the following...Ch. 32 - Test Your Understanding 7.Which of the following...Ch. 32 - Test Your Understanding 8.VISUALIZE Draw a simple...Ch. 32 - Test Your Understanding 9.EVOLUTION LINK Sea...Ch. 32 - Test Your Understanding 10.EVOLUTION LINK Most...Ch. 32 - Test Your Understanding 11.EVOLUTION LINK Discuss...Ch. 32 - Prob. 12TYUCh. 32 - Prob. 13TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning


Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
From Sea to Changing Sea | Early Life in the Oceans || Radcliffe Institute; Author: Harvard University;https://www.youtube.com/watch?v=Ac0TmDf5Feo;License: Standard youtube license