Concept explainers
Introduction:

Answer to Problem 1MCQ
Correct answer:
The mouse uses the most “energy per gram of body weight”. Therefore, option c. is correct.
Explanation of Solution
Reason for the correct statement:
The amount of energy needed to regulate each gram of body weight is inversely proportional to the size of the animal. The mouse has lesser weight as compared to python, eagle, and horse. So, the mouse will have more “energy per gram of body weight”.
Option c. is given as “mouse”.
As, “the mouse has the least weight, the “energy per gram of body weight”, is highest in the mouse” is the right answer.
Hence, option c. is correct.
Reasons for the incorrect statements:
Option a. is given as “horse”.
The horse weight is greater than that of the eagle and mouse. The “energy per gram of body weight” will be lesser of horse relative to that of eagle and mouse. So, it is a wrong answer.
Option b. is given as “eagle”.
The eagle weight is greater than that of the mouse. The “energy per gram of body weight” will be lesser of eagle relative to that of the mouse. So, it is a wrong answer.
Option d. is given as “python”.
The python weight is greatest in all the four animals “mouse”, “eagle”, “horse”, and “python”. The “energy per gram of body weight” will be least of the python. So, it is a wrong answer.
Hence, options a., b., and d. are incorrect.
The “energy per gram of body weight” is highest in the mouse because mouse weight is least among the four animals.
Want to see more full solutions like this?
Chapter 32 Solutions
BIOL:CONCEPT+INVEST.ETEXT
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
