Anatomy & Physiology (6th Edition)
6th Edition
ISBN: 9780134156415
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 3.10, Problem 1CYU
If one of the DNA strands being replicated “reads” CGAATG, what will be the base sequence of the corresponding DNA strand?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
On paper, replicate the following segment of DNA: (UPLOAD PHOTO OF
YOUR ANSWER)
5' ATCGGCTACGITCAC 3'
3'TAGCCGATGCAA GTG 5'
What is the DNA complement to this DNA sequence: TGAGCCTTAGGA?
O UCTCGGUUTCCT
O ACTCGGAATCCT
O ACUCGGAAUCCU
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand?
5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3'
a) Both sides
b) Neither side
c) The right side
d) The left side
Chapter 3 Solutions
Anatomy & Physiology (6th Edition)
Ch. 3.1 - Summarize the four key points of the cell theory.Ch. 3.1 - How would you explain the meaning of a generalized...Ch. 3.2 - What basic structure do all cellular membranes...Ch. 3.2 - What is the importance of the glycocalyx in cell...Ch. 3.2 - Prob. 3CYUCh. 3.2 - Phospholipid tails can be saturated or unsaturated...Ch. 3.3 - What is the energy source for all types of...Ch. 3.3 - What determines the direction of any diffusion...Ch. 3.3 - What are the two types of facilitated diffusion...Ch. 3.4 - What happens when the Na+-K+ pump is...
Ch. 3.4 - As a cell grows, its plasma membrane expands. Does...Ch. 3.4 - Prob. 3CYUCh. 3.4 - Which vesicular transport process allows a cell to...Ch. 3.5 - What process establishes the resting membrane...Ch. 3.5 - Is the inside of the plasma membrane negative or...Ch. 3.6 - What term is used to indicate signaling chemicals...Ch. 3.7 - Which organelle is the major site of ATP...Ch. 3.7 - What are three organelles involved in protein...Ch. 3.7 - Compare the functions of lysosomes and...Ch. 3.7 - How are microtubules and microfilaments related...Ch. 3.7 - Prob. 21CYUCh. 3.8 - Prob. 22CYUCh. 3.9 - If a cell ejects or loses its nucleus, what is its...Ch. 3.9 - What is the role of nucleoli?Ch. 3.9 - What is the role of nucleoli?Ch. 3.10 - If one of the DNA strands being replicated reads...Ch. 3.10 - During what phase of the cell cycle is DNA...Ch. 3.10 - What are three events occurring in prophase that...Ch. 3.11 - Codons and anticodons are both three-base...Ch. 3.11 - How do the A, P, and E ribosomal sites differ...Ch. 3.11 - What is the role of DNA in transcription?Ch. 3.12 - What is the importance of ubiquitin in the life of...Ch. 3.12 - Prob. 2CYUCh. 3 - The smallest unit capable of life by itself is (a)...Ch. 3 - Prob. 2MCCh. 3 - Prob. 3MCCh. 3 - The term used to describe the type of solution in...Ch. 3 - Osmosis always involves (a) a selectively...Ch. 3 - Prob. 6MCCh. 3 - Prob. 7MCCh. 3 - The endocytotic process in which a sampling of...Ch. 3 - Prob. 9MCCh. 3 - The nuclear substance composed of histone proteins...Ch. 3 - The information sequence that determines the...Ch. 3 - Mutations may be caused by (a) X rays, (b) certain...Ch. 3 - The phase of mitosis during which centrioles each...Ch. 3 - Final preparations for cell division are made...Ch. 3 - The RNA synthesized on one of the DNA strands is...Ch. 3 - The RNA species that travels from the nucleus to...Ch. 3 - If DNA has a sequence of AAA, then a segment of...Ch. 3 - A nerve cell and a lymphocyte are presumed to...Ch. 3 - Prob. 19MCCh. 3 - Explain why mitosis can be thought of as cellular...Ch. 3 - Contrast the roles of ER-bound ribosomes with...Ch. 3 - Cells lining the trachea have whiplike motile...Ch. 3 - Name the three phases of interphase and describe...Ch. 3 - Comment on the role of the sodium-potassium pump...Ch. 3 - Differentiate between primary and secondary active...Ch. 3 - Cell division typically yields two daughter cells,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The E. coli chromosome is 1.28 mm long. Under optimal conditions, thechromosome is replicated in 40 minutes.(a) What is the distance traversed by one replication fork in 1 minute?(b) If replicating DNA is in the B form (10.4 base pairs per turn), how manynucleotides are incorporated in 1 minute in one replication fork?(c) If cultured human cells (such as HeLa cells) replicate 1.2 m of DNAduring a five-hour S phase and at a rate of fork movement one-tenthof that seen in E. coli, how many origins of replication must the cellscontain?(d) What is the average distance, in kilobase pairs, between these origins?arrow_forwardThe E. coli chromosome is 1.28 mm long. Under optimal conditions the chromosome is replicated in 40 minutes. (a) What is the distance traversed by one replication fork in 1 minute? (b) If replicating DNA is in the B form (10.4 base pairs per turn), how many nucleotides are incorporated in 1 minute in one replica- tion fork? (c) If cultured human cells (such as Hela cells) replicate 1.2 m of DNA during a 5-hour S phase and at a rate of fork movement one- tenth of that seen in E. coli, how many origins of replication must the cells contain? (d) What is the average distance, in kilobase pairs, between these origins?arrow_forwardGive typing answer with explanation and conclusionarrow_forward
- Find the complement DNA sequences to the following DNA sequences:Sequence # 1: GATATAGTSequence # 2: GAGGTTCSequence # 3: AACTAGATSequence # 4: CCTATAAGSequence # 5: AACGTGATarrow_forwardIn the gel electrophoresis: the mutant would just run the same as the open circle DNA if it simply weren't able to close its circle. The mutant contains heavier than the single-stranded DNA because what kind of structure is it forming during replication? Wild-type phage DNA does not ever form a double-strand. What happens under denaturing conditions to that structure that helps explain that lane's smudge?In the sucrose centrifuging: what data from the gel electrophoresis support the conclusion?In the electrophoresis/Southern blot: which end of the DNA is the 1100 bp fragment, which end does the kinase ONLY work on?arrow_forwardDescribe the structural features of DNA that enable it to be replicated.arrow_forward
- On the right of the replication fork, which DNA strand (top or bottom) will be the template for Okazaki fragment synthesis? What will be the leading strand DNA sequence from the region 1 (answer with DNA sequence)? The following origin of replication is found on E. coli chromosome. The DNA sequence of region 1 is shown below: Region I (Top strand): 5'....CTGACTGACA...3'. 5 < top ofi bottom Region 1 inarrow_forwarda) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA, isolated form the two tissue types, to be the same? Why? (2) b) Provide one difference between DNA replication in eukaryotes and prokaryotes with regards to their origin(s) of replication. (1) For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). 14px E EY A Y BIVS Paragraph Arial ABC x² X2 ?次T Te 田田国王 用 图 +]arrow_forwardWhy can’t a linear duplex DNA, such as that of bacteriophage T7, be fully replicated by just E. coli-encoded proteins?arrow_forward
- As shown, telomerase attaches additional DNA, six nucleotides at a time, to the ends of eukaryotic chromosomes. However, it makes only one DNA strand. Describe how the opposite strand is replicated.arrow_forwardGive typing answer with explanation and conclusion What is the transcription product of the DNA templa GCTAGCGATGAC-5'? OA) CAGTAGCGATCG OB) CGAUCGCUACUG OC) CGATCGCTACUG OD) CGUTCGCUTCUGarrow_forwardGive only typing answer with explanation and conclusionarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY