
BIOLOGY:CONCEPTS+INVEST.-CONNECT ACCESS
5th Edition
ISBN: 9781260542233
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 30, Problem 2WIO
Summary Introduction
To determine:
What might be the dangers of having too many red blood cells. If some athletes turn to blood doping to gain an unfair competitive advantage. For example, they may take supplements of erythropoietin, a hormone that stimulates red blood cell production. Why would increasing the number of circulating red blood cells help an athlete.
Concept introduction:
The blood is consists of red blood cells, white blood cells and platelets. Red blood cell contains hemoglobin and is responsible for the transportation of oxygen and nutrients. White blood cells are involves in protection against foreign microorganisms and platelets are involved in clotting.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 30 Solutions
BIOLOGY:CONCEPTS+INVEST.-CONNECT ACCESS
Ch. 30.1 - What are the components of a circulatory system?Ch. 30.1 - Distinguish between open and closed circulatory...Ch. 30.1 - Describe the circulatory systems of fishes,...Ch. 30.2 - What are the components of blood?Ch. 30.2 - Prob. 2MCCh. 30.2 - Prob. 3MCCh. 30.3 - Prob. 1MCCh. 30.3 - Prob. 2MCCh. 30.4 - Why is the heart sometimes called two hearts that...Ch. 30.4 - Prob. 2MC
Ch. 30.4 - Prob. 3MCCh. 30.4 - Prob. 4MCCh. 30.5 - Prob. 1MCCh. 30.5 - Prob. 2MCCh. 30.5 - Prob. 3MCCh. 30.6 - Prob. 1MCCh. 30.6 - Prob. 2MCCh. 30.6 - Prob. 3MCCh. 30.7 - Prob. 1MCCh. 30.7 - Prob. 2MCCh. 30 - What is the advantage of a four-chambered heart?...Ch. 30 - Prob. 2MCQCh. 30 - Which of the following blood transfusions would be...Ch. 30 - Prob. 4MCQCh. 30 - Prob. 5MCQCh. 30 - Prob. 6MCQCh. 30 - Prob. 7MCQCh. 30 - How are open and closed circulatory systems...Ch. 30 - Prob. 2WIOCh. 30 - Prob. 3WIOCh. 30 - Prob. 4WIOCh. 30 - Prob. 5WIOCh. 30 - Describe the events that occur during one cardiac...Ch. 30 - Make a chart that compares systemic arteries,...Ch. 30 - Prob. 8WIOCh. 30 - Prob. 9WIOCh. 30 - Prob. 10WIOCh. 30 - The carotid artery extends from the heart to the...Ch. 30 - Prob. 12WIOCh. 30 - Prob. 13WIOCh. 30 - Name three ways that the circulatory system helps...Ch. 30 - Prob. 15WIOCh. 30 - Prob. 16WIOCh. 30 - Prob. 1PITCh. 30 - Prob. 2PITCh. 30 - Prob. 3PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning