
A.
To describe: The tests that could be done to confirm a diagnosis of hepatitis A.
Introduction: Hepatitis A is an extremely contagious liver disease caused by the hepatitis A virus. It is preventable by vaccine. It spreads from infected food or water or contact with the infected person. A physical exam, blood tests, and imaging examinations such as a sonogram or CAT scan and a liver biopsy can be applied to diagnose viral hepatitis. It could be Hepatitis A, Hepatitis B, or Hepatitis C.
A.

Explanation of Solution
The health care professional will initially inquire about your indications and review for high levels of liver enzymes in your blood. Next, they'll do more blood tests to look for immunoglobulin M (IgM) antibodies. The symptoms that are observed in hepatitis A infection are - fever, pain, loss of appetite, diarrhea, vomiting, intestinal discomfort, dark-colored urine, and jaundice.
B.
To describe: The most common modes of transmission for hepatitis A.
Introduction: The hepatitis A virus is carried principally by the fecal-oral route; that means when an uninfected person consumes food or water that has been infected with the feces of an infected person.
B.

Explanation of Solution
Usually, hepatitis A spreads when a person unintentionally consumes the virus from something, meals, or liquids polluted by small, undetected quantities of stool from an infected person. Hepatitis A can also develop from intimate personal contact with an infected person, such as through sexual contact or caring for someone who is ill. As the daughter of the patient attends daycare, the 24-year old woman might get infected through her.
C.
To describe: The methods that could be used to protect other family members from getting the disease.
Introduction: The family members must wash their hands thoroughly frequently. And also, after using the bathroom or after changing the diaper and before touching food or dining. Cleaning with soap and water is fine. However, alcohol-based sanitizers appear to be even more productive.
C.

Explanation of Solution
The vaccines for hepatitis A and hepatitis B are beneficial. They can be provided in separate injections or a mixed vaccine. Obey the lead of health-care workers and understand that all blood is contagious. Sharing goes fine with toys, tools but is a terrifying idea when it comes to toothbrushes, razor blades, nail files, and other personal objects. This involves medical devices and needles as well. Likewise, if you and your family members are concerned about hand to wash before eating and after using the bathroom, it’s likely to get hepatitis from meat or meal that’s been made by people who aren’t entirely so meticulous.
Thus, guiding and creating awareness for the family members might help to prevent the other people from getting affected.
Want to see more full solutions like this?
Chapter 30 Solutions
EBK ESSENTIALS OF PATHOPHYSIOLOGY
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





