Chapter 30, Problem 1P

Interpretation Introduction

Interpretation:

Whether one can reach an unambiguous conclusion from the given data should be determined.

Concept Introduction:

The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.

Answer to Problem 1P

No, we cannot reach an unambiguous conclusion.

Explanation of Solution

Given:

Partial amino acid sequence of the protein:

…CAATACGAAGCAATCCCGCGACTAGACCTTAAC…

To create any conclusion regarding the cDNA strand we should initially examine the sequence. After changing to its RNA form, we get the below strand.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

Initial thing is to find out the reading frame by looking for the initial codon AUG. There is no start CODON in the sequence.

Now, we look for the stop codons: UGA, UAG or UAA.

CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC

We now could see that there are stop codons for 2 of the 3 probable reading frames. It actually means that preceding codons account for the protein’s C-terminal. The third reading frame could start with CAA and would not have the stop codon in the protein of the DNA sequence which we are given.

More information is required to find out which is the correct reading frame.