Concept explainers
Interpretation:
Whether one can reach an unambiguous conclusion from the given data should be determined.
Concept Introduction:
The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.
Answer to Problem 1P
No, we cannot reach an unambiguous conclusion.
Explanation of Solution
Given:
Partial amino acid sequence of the protein:
…CAATACGAAGCAATCCCGCGACTAGACCTTAAC…
To create any conclusion regarding the cDNA strand we should initially examine the sequence. After changing to its RNA form, we get the below strand.
CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC
Initial thing is to find out the reading frame by looking for the initial codon AUG. There is no start CODON in the sequence.
Now, we look for the stop codons: UGA, UAG or UAA.
CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC
We now could see that there are stop codons for 2 of the 3 probable reading frames. It actually means that preceding codons account for the protein’s C-terminal. The third reading frame could start with CAA and would not have the stop codon in the protein of the DNA sequence which we are given.
More information is required to find out which is the correct reading frame.
Want to see more full solutions like this?
Chapter 30 Solutions
Study Guide With Student Solutions Manual And Problems Book For Garrett/grisham's Biochemistry, 6th
- Draw out the following peptide H-R-K-E-D at physiological pH (~7.4). Make sure toreference table 3.1 for pKa values.arrow_forwardThe table provides the standard reduction potential, E', for relevant half-cell reactions. Half-reaction E'° (V) Oxaloacetate² + 2H+ + 2e malate²- -0.166 Pyruvate + 2H+ + 2e → lactate -0.185 Acetaldehyde + 2H+ + 2e¯ →→→ ethanol -0.197 NAD+ + H+ + 2e--> NADH -0.320 NADP+ + H+ + 2e →→ NADPH Acetoacetate + 2H+ + 2e¯ - -0.324 B-hydroxybutyrate -0.346 Which of the reactions listed would proceed in the direction shown, under standard conditions, in the presence of the appropriate enzymes? Malate + NAD+ oxaloacetate + NADH + H+ Malate + pyruvate oxaloacetate + lactate Pyruvate + NADH + H+ lactate + NAD+ Pyruvate + p-hydroxybutyrate lactate + acetoacetate Acetaldehyde + succinate ethanol + fumerate Acetoacetate + NADH + H+ → B-hydroxybutyrate + NAD+arrow_forwardArrange the four structures in order from most reduced to most oxidized. Most reduced R-CH2-CH3 R-CH2-CH₂-OH R-CH,-CHO R-CH₂-COO Most oxidizedarrow_forward
- for each pair of biomolecules, identify the type of reaction (oxidation-reduction, hydrolysis, isomerization, group transfer, or nternal rearrangement) required to convert the first molecule to the second. In each case, indicate the general type of enzyme and cofactor(s) c reactants required, and any other products that would result. R-CH-CH-CH-C-S-COA A(n) A(n) A(n) A(n) Palmitoyl-CoA R-CH-CH=CH-C-S-CoA ° trans-A-Enoyl-CoA reaction converts palmitoyl-CoA to trans-A2-enoyl-CoA. This reaction requires and also produces Coo HN-C-H CH₂ CH₂ CH CH CH, CH, L-Leucine CH, CH, D-Leucine 8/6881 COO HÌNH: reaction converts L-leucine to D-leucine. This reaction is catalyzed by a(n) H-C-OH H-C-OH C=0 HO-C-H HO-C-H H-C-OH H-C-OH H-C-OH CH,OH Glucose H-C-OH CH,OH Fructose OH OH OH CH-C-CH₂ reaction converts glucose to fructose. This reaction is catalyzed by a(n) OH OH OPO I CH-C-CH H Glycerol Glycerol 3-phosphate H reaction converts glycerol to glycerol 3-phosphate. This reaction requires H,N- H,N H…arrow_forwardAfter adding a small amount of ATP labeled with radioactive phosphorus in the terminal position, [7-32P]ATP, to a yeast extract, a researcher finds about half of the 32P activity in P; within a few minutes, but the concentration of ATP remains unchanged. She then carries out the same experiment using ATP labeled with 32P in the central position, [ẞ-³2P]ATP, but the 32P does not appear in P; within such a short time. Which statements explain these results? Yeast cells reincorporate P; released from [ß-³2P]ATP into ATP more quickly than P¡ released from [y-³2P]ATP. Only the terminal (y) phosphorous atom acts as an electrophilic target for nucleophilic attack. The terminal (y) phosphoryl group undergoes a more rapid turnover than the central (B) phosphate group. Yeast cells maintain ATP levels by regulating the synthesis and breakdown of ATP. Correct Answerarrow_forwardCompare the structure of the nucleoside triphosphate CTP with the structure of ATP. NH₂ 0- 0- 0- ·P—O—P—O—P—O—CH₂ H H H H OH OH Cytidine triphosphate (CTP) Consider the reaction: ATP + CDP ADP + CTP NH 0- 0- 0- ¯0— P—O— P—O—P-O-CH₂ H Η о H H OH OH Adenosine triphosphate (ATP) NH₂ Now predict the approximate K'eq for this reaction. Now predict the approximate AG for this reaction. Narrow_forward
- The standard free energy, AGO, of hydrolysis of inorganic polyphosphate, polyP, is about −20 kJ/mol for each P; released. In a cell, it takes about 50 kJ/mol of energy to synthesize ATP from ADP and Pi. ○ P O Inorganic polyphosphate (polyP) Is it feasible for a cell to use polyP to synthesize ATP from ADP? Why or why not? No. The reaction is unidirectional and always proceeds in the direction of polyP synthesis from ATP. Yes. If [ADP] and [polyP] are kept high, and [ATP] is kept low, the actual free-energy change would be negative. No. The synthesis of ATP from ADP and P; has a large positive G'o compared to polyP hydrolysis. Yes. The hydrolysis of polyP has a sufficiently negative AG to overcome the positive AGO of ATP synthesis. Correct Answerarrow_forwardIn the glycolytic pathway, a six-carbon sugar (fructose 1,6-bisphosphate) is cleaved to form two three-carbon sugars, which undergo further metabolism. In this pathway, an isomerization of glucose 6-phosphate to fructose 6-phosphate (as shown in the diagram) occurs two steps before the cleavage reaction. The intervening step is phosphorylation of fructose 6-phosphate to fructose 1,6-bisphosphate. H H | H-C-OH H-C-OH C=0 HO-C-H HO-C-H phosphohexose isomerase H-C-OH H-C-OH H-C-OH H-C-OH CH₂OPO CH₂OPO Glucose 6-phosphate Fructose 6-phosphate What does the isomerization step accomplish from a chemical perspective? Isomerization alters the molecular formula of the compound, allowing for subsequent phosphorylation. Isomerization moves the carbonyl group, setting up a cleavage between the central carbons. Isomerization causes the gain of electrons, allowing for the eventual release of NADH. Isomerization reactions cause the direct production of energy in the form of ATP.arrow_forwardFrom data in the table, calculate the AG value for the reactions. Reaction AG' (kJ/mol) Phosphocreatine + H₂O →>> creatine + P -43.0 ADP + Pi → ATP + H₂O +30.5 Fructose +P → fructose 6-phosphate + H₂O +15.9 Phosphocreatine + ADP creatine + ATP AG'O ATP + fructose → ADP + fructose 6-phosphate AG'° kJ/mol kJ/molarrow_forward
- Macmillan Learning The phosphorylation of glucose to glucose 6-phosphate is the initial step in the catabolism of glucose. The direct phosphorylation of glucose by P, is described by the equation Glucose + P ← glucose 6-phosphate + H₂O AG = 13.8 kJ/mol Coupling ATP hydrolysis to glucose phosphorylation makes thermodynamic sense, but consider how the coupling might take place. Given that coupling requires a common intermediate, one conceivable mechanism is to use ATP hydrolysis to raise the intracellular concentration of Pi. The increase in P; concentration would drive the unfavorable phosphorylation of glucose by Pi- Is increasing the P; concentration a reasonable way to couple ATP hydrolysis and glucose phosphorylation? No. The phosphate salts of divalent cations would be present in excess and precipitate out. Yes. Increasing the concentration of P; would decrease K'eq and shift equilibrium to the right. Yes. The extra ATP hydrolysis would provide enough free energy to drive the…arrow_forwardThe phosphorylation of glucose to glucose 6-phosphate is the initial step in the catabolism of glucose. The direct phosphorylation of glucose by P, is described by the equation Glucose + P → glucose 6-phosphate + H₂O AG' = 13.8 kJ/mol In principle, at least, one way to increase the concentration of glucose 6-phosphate (G6P) is to drive the equilibrium reaction to the right by increasing the intracellular concentrations of glucose and Pj. The maximum solubility of glucose is less than 1 M, and the normal physiological concentration of G6P is 250 μM. Assume a fixed concentration of P, at 4.8 mM. The calculated value of K'cq is 4.74 × 10-³ M-¹. Calculate the intracellular concentration of glucose when the equilibrium concentration of glucose 6-phosphate is 250 μM, the normal physiological concentration. [glucose] = 10.99 Correct Answer Would increasing the concentration of glucose be a physiologically reasonable way to increase the concentration of G6P? No. Because the concentration of P,…arrow_forwardCalculate the equilibrium constant for the phosphorylation of glucose to glucose 6-phosphate at 37.0 °C. K'eq = M-' In the rat hepatocyte, the physiological concentrations of glucose and P, are maintained at approximately 4.8 mM. What is the equilibrium concentration of glucose 6-phosphate (G6P) obtained by the direct phosphorylation of glucose by P.? [G6P] = Does this reaction represent a reasonable metabolic step for the catabolism of glucose? Why or why not? Yes, because the value of AG" is positive. No, because the K'eq is too large for the reaction to proceed in the forward direction. Yes, because AG is negative at the calculated value of K'eq No, because [G6P] is likely to be higher than the calculated value. Marrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax