
Concept explainers
Interpretation:
Whether one can reach an unambiguous conclusion from the given data should be determined.
Concept Introduction:
The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.

Answer to Problem 1P
No, we cannot reach an unambiguous conclusion.
Explanation of Solution
Given:
Partial amino acid sequence of the protein:
…CAATACGAAGCAATCCCGCGACTAGACCTTAAC…
To create any conclusion regarding the cDNA strand we should initially examine the sequence. After changing to its RNA form, we get the below strand.
CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC
Initial thing is to find out the reading frame by looking for the initial codon AUG. There is no start CODON in the sequence.
Now, we look for the stop codons: UGA, UAG or UAA.
CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC
We now could see that there are stop codons for 2 of the 3 probable reading frames. It actually means that preceding codons account for the protein’s C-terminal. The third reading frame could start with CAA and would not have the stop codon in the protein of the DNA sequence which we are given.
More information is required to find out which is the correct reading frame.
Want to see more full solutions like this?
Chapter 30 Solutions
Study Guide With Student Solutions Manual And Problems Book For Garrett/grisham's Biochemistry, 6th
- Show the fate of the hydrogen on carbon-2 of glucose.arrow_forwardImagine that aldolase can react with the seven carbon molecule Sedoheptulose-1,7-bisphosphate (below). Use the mechanism to predict the two products generated.arrow_forwardShow the mechanisms of PGK and PFK-1. How are they different?arrow_forward
- Show the fate of the proton on the 4-Oxygen molecule of F-1,6-BP.arrow_forwardSodium borohydride (NaBH4) is a potent inhibitor of aldolase. It is known to ONLY inhibit theenzyme when it is complexed with substrate. Treatment of the enzyme alone has no effect.What is the mechanism for this inhibition?arrow_forwardA non-hydrolysable ATP (AMPPNP - below) is ingested by a graduate student on a dare. Whateffects would you anticipate on his metabolism?arrow_forward
- Show the mechanism for the acid-catalyzed formation of an [α-1,6] glycosidic linkagebetween two molecules of α-D-glucopyranose. Please sketch the structure and use arrows showing electron flow!arrow_forwardI am a Biochemistry student and I am confused on how to analyze FRAP Analysis using Excel Spread Sheets. The following spread sheet has my 0 minute data listed at top and the 4 minute data listed on the bottom. Sheet: https://mnscu-my.sharepoint.com/:x:/g/personal/vi2163ss_go_minnstate_edu/EXjrCizWiXRPmpittqZA12IB8EkB5eE8iaRqj_iun-IAtg?rtime=Wo9zPHFY3Ug The formula for FRAP Analysis is: FRAP value = A (4 min sample) - A (0 min sample) over A (4 min 30 uM ascorbic acid) - A (0 min 30 uM ascorbic acid) multiplied by 30 uM and the dilution factor of 1/10arrow_forwardHO Fill in the missing boxes. ON 800 NO NO Glucose ATP NADH Hexokinase 1,3-Bisphosphoglycerate Mg2+ ADP NAD+, Pi Phosphoglucose Isomerase Glucose-6-Phosphate ON 沁 Glyceraldehyde-3-Phosphate HO حلمة ADP ADP Phospho Mg2+ glycerate Dihydroxyacetone Phosphate ATP kinase ATP Phosphoglycerate 3-phosphoglycerate Mutase H₁₂O Fructose-6-Phosphate ATP Mg2+ ADP Fructose-1,6-Bisphosphate 2-phosphoglycerate H₂O Phosphoenolpyruvate ADP Mg2+ ATP Pyruvatearrow_forward
- In a diffraction experiment of a native crystal, intensity of reflection (-1 0 6) is equivalent to the intensity of reflection (1 0 -6). true or false?arrow_forwardin an x-ray diffraction experiment, moving the detector farther away from the crystal will allow collection of reflection of reflections with high Miller indices. true or false?arrow_forwardShow the mechanism for the acid-catalyzed formation of an [α-1,6] glycosidic linkagebetween two molecules of α-D-glucopyranose.arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax





