Hole's Human Anatomy & Physiology
15th Edition
ISBN: 9781259864568
Author: SHIER, David, Butler, Jackie, Lewis, Ricki
Publisher: Mcgraw-hill Education,
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 3, Problem 3IA
Summary Introduction
To state:
The part of a cell reprogrammed to function like that of a stem cell for experimental stem cell therapy and stimulated to differentiate in a particular way.
Introduction:
The stem cell therapy is the treatment of a variety of disorders using stem cells. Stem cells are the cells that divide mitotically to produce two daughter cells. These cells can continue dividing without any specialization, or one of the formed daughter cells can become stem cell while the other daughter cell can be partially specialized.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
Chapter 3 Solutions
Hole's Human Anatomy & Physiology
Ch. 3 - Prob. 1PCh. 3 - Prob. 2PCh. 3 - Prob. 3PCh. 3 - Prob. 4PCh. 3 - Prob. 5PCh. 3 - Prob. 6PCh. 3 - Prob. 7PCh. 3 - Prob. 8PCh. 3 - Distinguish between organelles and inclusions.Ch. 3 - Prob. 10P
Ch. 3 - 11 Describe how the Golgi apparatus functions.
Ch. 3 - Prob. 12PCh. 3 - Prob. 13PCh. 3 - Prob. 14PCh. 3 - Prob. 15PCh. 3 - Prob. 16PCh. 3 - Prob. 17PCh. 3 - Prob. 18PCh. 3 - Prob. 19PCh. 3 - Distinguish among isotonic hypertonic, and...Ch. 3 - Explain how filtration occurs in the body.Ch. 3 - How does a cell maintain unequal concentrations of...Ch. 3 - Prob. 23PCh. 3 - Prob. 24PCh. 3 - Prob. 25PCh. 3 - Prob. 26PCh. 3 - Prob. 27PCh. 3 - Prob. 28PCh. 3 - Prob. 29PCh. 3 - Prob. 30PCh. 3 - Prob. 31PCh. 3 - Prob. 32PCh. 3 - Prob. 33PCh. 3 - Prob. 34PCh. 3 - Prob. 35PCh. 3 - Prob. 36PCh. 3 - Prob. 37PCh. 3 - Prob. 38PCh. 3 - Prob. 39PCh. 3 - What are the units used to measure cells? (p. 83)...Ch. 3 - Prob. 2CACh. 3 - Prob. 3CACh. 3 - Prob. 4CACh. 3 - Prob. 5CACh. 3 - Prob. 6CACh. 3 - Prob. 7CACh. 3 - Prob. 8CACh. 3 - Prob. 9CACh. 3 - Prob. 10CACh. 3 - Prob. 11CACh. 3 - List the parts of the nucleus and explain why each...Ch. 3 - Prob. 13CACh. 3 - Prob. 14CACh. 3 - Prob. 15CACh. 3 - Prob. 16CACh. 3 - Prob. 17CACh. 3 - Explain how transcytosis combines endocytosis...Ch. 3 - Prob. 19CACh. 3 - Explain why interphase is not a period of rest for...Ch. 3 - Prob. 21CACh. 3 - Prob. 22CACh. 3 - Prob. 23CACh. 3 - Prob. 24CACh. 3 - Prob. 25CACh. 3 - Discuss the consequences of too little cell...Ch. 3 - Prob. 27CACh. 3 - Prob. 28CACh. 3 - Prob. 29CACh. 3 - Prob. 30CACh. 3 - Prob. 31CACh. 3 - Prob. 32CACh. 3 - Prob. 33CACh. 3 - Prob. 34CACh. 3 - Prob. 35CACh. 3 - Prob. 36CACh. 3 - Prob. 1IACh. 3 - Prob. 2IACh. 3 - Prob. 3IACh. 3 - Prob. 4IACh. 3 - Prob. 5IACh. 3 - Prob. 6IACh. 3 - Prob. 7IA
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Developmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
The Cell Cycle and its Regulation; Author: Professor Dave Explains;https://www.youtube.com/watch?v=eqJqhA8HSJ0;License: Standard YouTube License, CC-BY
Cell Division - Mitosis and Meiosis - GCSE Biology (9-1); Author: Mr Exham Biology;https://www.youtube.com/watch?v=w7vp_uRA8kw;License: Standard YouTube License, CC-BY