
Concept explainers
To compare:
The chemical structure of a trans-fat and a non-trans fat.
Introduction:
Trans-fats are basically unsaturated fats found in minute amounts in nature. These are widely produced by the hydrogenation of unsaturated fatty acids. Industrial production of trans-fats takes place from vegetable fats and are used in snack food, margarine, and frying fast food.
Pictorial representation: Fig.1: Chemical structure of trans fat and non-trans fat.
Fig.1: Chemical structure of trans fat and non-trans fat.

Explanation of Solution
The saturated fats are also called non-trans fats. The major differences between trans and non-trans fats are as follows:
Trans fat | Non-trans fat |
---|---|
Trans fat is made up of unsaturated fatty acids through partial hydrogenation process. | Non-trans fats consist of saturated fatty acids that do not contain double bonds. |
These are produced in industries through partial hydrogenation of vegetable oils. | These occur naturally in animal food sources. |
These fats increase LDL (low density lipoproteins) levels and decrease HDL (high density lipoproteins) levels in the blood. | These fats increase both HDL and LDL levels in the blood. |
Trans fat increases the risk of cardiovascular diseases. | Non-trans fat reduces the risk of cardiovascular diseases. |
Trans fat increase the risk of cardiovascular diseases and should not be consumed more than 1% in the diet.
Want to see more full solutions like this?
Chapter 3 Solutions
Lab Manual for Biology
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





