
Concept explainers
Which of the following would you expect to find in or on cells whose main function is absorption?
a. Microvilli
c. Gap junctions
b. Cilia
d. Secretory vesicles

Introduction:
Cells are the smallest structural and functional unit of life. The cell has many specialized structures that perform specific functions that are required for proper growth and development of an organism.
Answer to Problem 1MC
Correct answer:
The cells specialized to perform absorption have microvilli over their surfaces. These are hair-like structures that increase the surface area of the cells.
Justification for the correct answer:
Option (a) is given that the cells whose main function is absorption have microvilli in or on them. The body organs like intestines and kidneys perform the function of absorption. Thus, the cells of these organs should have large surface area. This is accomplished by the presence of microvilli (hair-like structures) that extend outward from the plasma membrane.
These provide a brush lining and increase the area of absorption of various nutrients. They also perform the secretory function of some factors. Microvilli are generally present in the small intestine, surface of egg cells, and white blood cells. Hence, option (a) is correct.
Explanation of Solution
Explanation for incorrect answers:
Option (b) is given that the cells whose main function is absorption have cilia in or on them. The cilia are specialized structures on the surface of the cells and provide motility to the cell, in case of prokaryotes. In case of eukaryotes, they perform the function of moving the contents of the organs further. So, it is a wrong answer.
Option (c) is given that the cells whose main function is absorption have gap junctions in or on them. Gap junctions mainly function to pass the ions and molecules freely through the cells. They help in establishing an electrical communication between the cells. So, it is a wrong answer.
Option (d) is given that the cells whose main function is absorption have secretory vesicles in or on them. The secretory vesicles mediate the vesicular transport of cargo between different cells, like hormones or neurotransmitters. So, it is a wrong answer.
Hence, options (b), (c), and (d) are incorrect.
The cells that are specialized to perform the function of absorption are lined by microvilli.
Want to see more full solutions like this?
Chapter 3 Solutions
Essentials of Human Anatomy & Physiology (12th Edition)
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax



