Campbell Biology: Concepts & Connections (9th Edition)
9th Edition
ISBN: 9780134296012
Author: Martha R. Taylor, Eric J. Simon, Jean L. Dickey, Kelly A. Hogan, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 3, Problem 12TYK
Sucrose is broken down in your intestine to the monosaccharides glucose and fructose, which are then absorbed into your blood. What is the name of this type of reaction? Using this diagram of sucrose, show how this would occur.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In enzymatic hydrolysis, the bonds of starch are broken to obtain glucose.
How does this process work? What kind of reaction occurs?
A glycogen polymer and an amylopectin polymer, each containing 100 monosaccharide subunits, are cleaved completely by an enzyme. How many individual glucose molecules are created during this process?
Maltase is an enzyme that catalyzes the hydrolysis of the disaccharide maltose. This process occurs during human digestion when maltase is secreted by the intestine and then converts maltose into glucose. Which two classes of biomolecules are directly involved in this process?
Chapter 3 Solutions
Campbell Biology: Concepts & Connections (9th Edition)
Ch. 3 - Complete the following table to help you review...Ch. 3 - A glucose molecule is to starch as (Explain your...Ch. 3 - What makes a fatty acid an acid? a. It does not...Ch. 3 - Cows can derive nutrients from cellulose because...Ch. 3 - Of the following functional groups, which is/are...Ch. 3 - Prob. 6TYKCh. 3 - Prob. 7TYKCh. 3 - Prob. 8TYKCh. 3 - Which structural level of a protein would be least...Ch. 3 - Circle and name the functional groups in this...
Ch. 3 - Most proteins are soluble in the aqueous...Ch. 3 - Sucrose is broken down in your intestine to the...Ch. 3 - Explain the role of complementary base pairing in...Ch. 3 - What are the two types of secondary structures...Ch. 3 - The diversity of life is staggering. Yet the...Ch. 3 - How can a cell make many different kinds of...Ch. 3 - Given that the function of egg yolk is to nourish...Ch. 3 - Enzymes usually function best at an optimal pH and...Ch. 3 - SCIENTIFIC THINKING Another aspect of the Nurses...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- An individual consumes a bag of plantain chips fried in coconut oil (Yes, it happens, and it's delicious!). Plantains are "cooking bananas" that, when unripe, are full of starch (glucose sub-units). Coconut oil is mainly composed of the fatty acid palmitic acid (C16:0). Let's say that he ate the equivalent of 15,000 molecules of glucose (from starch digestion) and 20,000 molecules of palmitic acid. Almost immediately, he goes running and weight-lifting, ensuring that all the glucose from starch and all the palmitic acid are transported to skeletal muscle cells. 10 Assume the following: • You net 2 ATP and 2 NAH from the glycolysis of 1 glucose molecule, You net 3 ATPs per NADH and 2 ATPs per FADH», There is no cost for NADH transport from the cytosol into mitochondria, nor is there a cost for GTP _ ATP conversion. ( a)) How many total number of ATPs did the individual's skeletal muscle cells make from the nutrients obtained from this snack? Type calculations clearlyarrow_forwardWhen glucose is reduced, only one alditol is produced.When fructose undergoes the same reaction, however,two diasteriomeric sugars are produced. Draw theirstructures.arrow_forwardThe following reaction would most likely be catalyzed by an enzyme of which class? sucrose + H2O → glucose + fructosearrow_forward
- Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forwardFor each of the four possibilities listed below (a through d), only one answer is correct and the others are false. Identify the correct statement and explain why the others are false. In your answer, write CORRECT next to the statement that you think is true, and ONLY for the ones that you think are false, explain what is wrong with the statement . When glucose reacts with ATP to form glucose-6-phosphate (as shown on the figure below): 1. The synthesis of glucose-6-phosphate is exergonic 2. ADP is at a higher energy level than ATP 3. Glucose-6-phosphate is at a higher energy level than glucose 4. Because ATP donates a phosphate to glucose, this is not a coupled reactionarrow_forwardDraw the structure of the a-keto acid formed by removal of the amino group during the catabolism of cysteine. Note: Reference the Naturally-occurring amino acids table for additional information. Click and drag to start drawing a structure. ☑arrow_forward
- An oligosaccharide is a repeating unit of a-D-galactopyranosyl-(a-1 >3)-allopyranoside. Each disaccharide unit is linked via B-1 --->4 glycosidic bond. The oligosaccharide has 10 monosaccharide residues. Required: Is this oligosaccharide a good substrate for glycolysis? Why or why not? Provide two reasons and discuss corn prehensively.arrow_forwardThe storage polysaccharide starch is a mixture of the molecules amylose (an unbranched polymer of glucose) and amylopectin (a branched polymer of glucose). Both amylose and amylopectin only have one reducing end, but amylopectin has many nonreducing ends.Enzymes that break down these molecules act on the nonreducing ends. Briefly describe why this is advantageous.arrow_forwardThe aldolase reaction cleaves fructose-1,6-bisphosphate to make G-3-P and DHAP. Draw the structures of the reactants and the products in the space below.arrow_forward
- Name the following enzymes:a. enzyme responsible for the cutting of the sugar on the nonreducing ends of glycogen branches b. enzyme that is only present in the liver and kidney during glycogen utilization c. enzyme that catalyzes the transfer of a two-carbon fragment from a ketose donor to an aldose acceptor in PPParrow_forwardDraw the structure of the a-keto acid formed by removal of the amino group during the catabolism of leucine. Note: Reference the Naturally-occurring amino acids table for additional information. Click and drag to start drawing a structure. 口:肚arrow_forwardThe urea cycle can be summarized through the following reaction: O || H2N-C-OPO3 + COO- | H3N-CHCH₂COO b. O || H2N-C-NH2 1a Write the reactions, using structural formulas that lead to the formation of carbamoyl phosphate and its subsequent incorporation into the urea cycle. Name the enzymes and how they are activated. 1 + OOCCH=CHCOO- Write the rest of the reactions that constitute the urea cycle using structural formulas. Name the enzymes that catalyze each reaction. Indicate which reactions occur in the mitochondrion and which occur in the cytoplasm.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Metabolic Pathways; Author: Wisc-Online;https://www.youtube.com/watch?v=m61bQYio9ys;License: Standard Youtube License