
To review:
Koch’s postulates and design the study using Koch’s postulates to test the hypothesis that chytrid infections are responsible for the frog deaths.
Introduction:
Koch’s postulates state that the microorganism must be present in all the diseased individuals, but it must be absent in the healthy organism. The table mentioning that the chytrids are responsible for massive die-offs occurring in amphibians is given below:
Known species | Absorptive lifestyle | Life cycle | Relevance | |
Chytrids (common in freshwater) | 750 | Many decompose the plants by digesting the cellulose. Mutualistic chytrids reside in the guts of deer, cows, and other mammals and help in the digestion of plant material. |
These are the only fungi that produce motile cells—both their gametes and spores through flagella. Most exhibit alteration of generations. |
Some are parasites of mosquitos. Batrachochytrium dendrobatidis is mainly responsible for the decline in the populations of amphibians worldwide. |

Want to see the full answer?
Check out a sample textbook solution
Chapter 29 Solutions
Biological Science (6th Edition)
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning



