Concept explainers
Introduction:
Many organisms attack other organisms and cause infectious diseases. These are known as pathogens. However, the body contains a well-defined organ system that fights with the pathogen. This protective organ system is termed as the immune system. The major function of the immune system is to fight against the invading pathogens.

Answer to Problem 1MCQ
Correct answer:
Lymph is a major component of the lymphatic system. It originates from plasma and moves from the circulatory system with the help of blood vessels. Hence, the correct answer is option b.
Explanation of Solution
Reason for correct answer:
Option b. is given as, “plasma that leaks out of blood vessels.”
The organ system that collects all the leaked body fluids and helps in the destruction of pathogens is termed as the lymphatic system. Lymph is a vital fluid of this system. It originates from the blood plasma and moves out of the circulatory system through the blood vessels. After this, the lymph collects all the invading pathogens and gets absorbed by the lymphatic vessels. In this way, the pathogens are attacked by the lymphatic system.
Reason for incorrect answer:
Option a. is given as, “Blood that contains important pathogens.”
Lymph is a fluid that originates from the plasma present in the blood. It moves out of the circulatory system through the blood vessels. After this, the lymph collects all the invading pathogens and gets absorbed by the lymphatic vessels. In this way, the pathogens are attacked by the lymphatic system. However, lymph is not blood. Hence, option a. is incorrect.
Option c. is given as, “Any part of the body that contains immune cells.”
Lymph is a vital fluid of the lymphatic system. It originates from the blood plasma and moves out of the circulatory system through the blood vessels. After this, the lymph collects all the invading pathogens and gets absorbed by the lymphatic vessels. However, it does not contains any immune cells. Hence, option c. is incorrect.
Option d. is given as, “Pathogen-catching fluid produced at the spleen.”
Lymph originates from the blood plasma and moves out of the circulatory system through the blood vessels. Spleen is not responsible for the production of lymph. After this, the lymph collects all the invading pathogens and gets absorbed by the lymphatic vessels. In this way, the pathogens are attacked by the lymphatic system. Hence, option d. is incorrect.
Hence, the options a., c., and d. are incorrect.
Lymph is a type of blood plasma that helps in the destruction of attacking pathogens and protects the body from infectious diseases. Thus, the correct option is b.
Want to see more full solutions like this?
Chapter 29 Solutions
BIOLOGY:ESSENTIALS NSU (LL)-W/ACCESS
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College


