
Biology: Concepts and Investigations
4th Edition
ISBN: 9780078024207
Author: Mariëlle Hoefnagels Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 27.1, Problem 5MC
Summary Introduction
To explain:
The sensory adaptation and also explain its benefits to the humans.
Concept introduction:
Sensory adaptation is the phenomenon of being adaptable to a continuous stimulation by a stimulus. In this process, the sensation by a particular stimulus becomes less noticeable after the prolonged exposure to the stimulus.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?
Chapter 27 Solutions
Biology: Concepts and Investigations
Ch. 27.1 - Prob. 1MCCh. 27.1 - Prob. 2MCCh. 27.1 - Prob. 3MCCh. 27.1 - Prob. 4MCCh. 27.1 - Prob. 5MCCh. 27.2 - Prob. 1MCCh. 27.2 - Prob. 2MCCh. 27.3 - Prob. 1MCCh. 27.3 - Prob. 2MCCh. 27.4 - Prob. 1MC
Ch. 27.4 - Prob. 2MCCh. 27.4 - Prob. 3MCCh. 27.5 - What are the parts of the ear, and how do they...Ch. 27.5 - How does the vestibular apparatus provide the...Ch. 27.6 - Prob. 1MCCh. 27.6 - Prob. 2MCCh. 27 - As you snuggle into bed, you feel the weight of...Ch. 27 - Prob. 2MCQCh. 27 - Prob. 3MCQCh. 27 - The structures that enable bees to see flowers are...Ch. 27 - What is the function of hair cells in the cochlea?...Ch. 27 - A male moth uses his antennae to detect the...Ch. 27 - Prob. 2WIOCh. 27 - Prob. 3WIOCh. 27 - Try as you might, you cannot tickle yourself....Ch. 27 - How does the nervous system differentiate among...Ch. 27 - Prob. 6WIOCh. 27 - Explain why some people hold their nose when...Ch. 27 - Suppose you put on glasses belonging to someone...Ch. 27 - Prob. 9WIOCh. 27 - Prob. 10WIOCh. 27 - In a rare condition called synesthesia,...Ch. 27 - Prob. 1PITCh. 27 - Prob. 2PITCh. 27 - Prob. 3PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
- Biology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forwardUnit Conversions: If the field of view at 10x is 3.1x106 µm2, what would it be in mm2. Report your answer with 2 significant digits. 1 mm = 1000 µm. Include units in your answer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
The Sensorimotor System and Human Reflexes; Author: Professor Dave Explains;https://www.youtube.com/watch?v=M0PEXquyhA4;License: Standard youtube license