The sequences of the mature RNA. Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG. Given: The sequence of the sense strand of a mammalian gene is as follows: TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.

Question

Draw a typical axodendritic synapse, including a specific neurotransmitter of your choice, its associated postsynaptic receptors (indicating whether they are ionotropic or metabotropic), and any associated reuptake transporters or degradation enzymes. Please include a description of what specific steps would occur as an action potential reaches the axonal terminal.

Answer 1

Question

Chapter 27, Problem 24CQ

Summary Introduction

To determine: The sequences of the mature RNA.

Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG.

Given: The sequence of the sense strand of a mammalian gene is as follows:

TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT

Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.

Summary Introduction

To determine: The sequences of encoded protein.

Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG.

Given: The sequence of the sense strand of a mammalian gene is as follows:

TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT

Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.

Expert Solution & Answer

Trending nowThis is a popular solution!

See solution

Check out sample textbook solution

Students have asked these similar questions

Draw a typical axodendritic synapse, including a specific neurotransmitter of your choice, its associated postsynaptic receptors (indicating whether they are ionotropic or metabotropic), and any associated reuptake transporters or degradation enzymes. Please include a description of what specific steps would occur as an action potential reaches the axonal terminal.

Give a full arrow pushing mechanism of the spontaneous redox reaction between NAD+/NADH and oxaloacetate/malate. Please include diagram drawing of the mechanism! (Thank You!)

18. Which one of the compounds below is the major organic product obtained from the following series of reactions? 1. BH3 2. H2O2, NaOH H₂CrO4 CH2N2 oro ororos A B C D E