
Concept explainers
(a)
To identify: The DNA sequence for the given sequence that encodes peptides of vir-1 and vir-2.
Concept introduction: Protein molecules are the essential nutrients of the body. Proteins are synthesized in the ribosomes of the cell. Transcription is the process of the production of mRNA from the DNA molecules. mRNA sequences carry the information from one generation to another. Translation is the process of synthesizing protein molecules.
Given: AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT.
(b)
To determine: The amino acid sequence for the peptides of vir-1 and vir-2.
Concept introduction: Protein molecules are the essential nutrients of the body. Proteins are synthesized in the ribosomes of the cell. Transcription is the process of the production of mRNA from the DNA molecules. mRNA sequences carry the information from one generation to another. Translation is the process of synthesizing protein molecules.
Given: AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT.
(c)
To determine: The amino acid sequence for the peptides of vir-1 and vir-2 that are encoded by mutant viruses where T, at position 23, is replaced by G.
Concept introduction: The protein molecules are the essential nutrients of the body. Proteins are synthesized in the ribosomes of the cell. Transcription is the process of the production of mRNA from the DNA molecules. mRNA sequences carry the information from one generation to another. Translation is the process of synthesizing protein molecules.
Given: AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT.

Want to see the full answer?
Check out a sample textbook solution
Chapter 27 Solutions
Fundamentals of Biochemistry: Life at the Molecular Level
- Assume that an enzyme-catalyzed reaction follows the scheme shown: E+S SES →E + P k₁ = 1 x 109/M-s k-1=2.5 x 10%/s k₂ = 3.4 x 107/s What is the dissociation constant for the enzyme-substrate, K,? What is the Michaelis constant, Km, for this enzyme? What is the turnover number, Keat, for this enzyme? What is the catalytic efficiency for the enzyme? If the initial Et concentration is 0.25mM, what is Vmax?arrow_forwardAn enzyme lowers the activation energy, (AG) of a reaction from 50.0 kcal/mol to 40.0 kcal/mol. Calulate the catalytic power at 310K. (R-1.987x10 kcal/mol)arrow_forwardDraw a typical axodendritic synapse, including a specific neurotransmitter of your choice, its associated postsynaptic receptors (indicating whether they are ionotropic or metabotropic), and any associated reuptake transporters or degradation enzymes. Please include a description of what specific steps would occur as an action potential reaches the axonal terminal.arrow_forward
- Give a full arrow pushing mechanism of the spontaneous redox reaction between NAD+/NADH and oxaloacetate/malate. Please include diagram drawing of the mechanism! (Thank You!)arrow_forward18. Which one of the compounds below is the major organic product obtained from the following series of reactions? 1. BH3 2. H2O2, NaOH H₂CrO4 CH2N2 oro ororos A B C D Earrow_forward17. Which one of the compounds below is the major organic product obtained from the following series of reactions? CI benzyl alcohol OH PBr3 Mg 1. CO2 SOCl2 ? ether 2. H+, H₂O CI Cl HO OH CI Cl A B C D Earrow_forward
- 14. What is the IUPAC name of this compound? A) 6-hydroxy-4-oxohexanenitrile B) 5-cyano-3-oxo-1-pentanol C) 5-cyano-1-hydroxy-3-pentanone D) 1-cyano-5-hydroxy-3-pentanone E) 5-hydroxy-3-oxopentanenitrile HO. CNarrow_forward13. What is the IUPAC name of this compound? A) 5-hydroxy-3,3-dimethylpentanoic acid B) 3,3-dimethylpentanoic acid C) 3,3-dimethyl-1-oxo-1,5-pentanediol D) 1,5-dihydroxy-3,3-dimethylpentanal E) 4-hydroxy-2,2-dimethylbutanoic acid HO OHarrow_forwardHelp me understand how carbon disulfide leads to toxicity in the brain, using terms like distal axonopathy, neurofilaments, covalent cross-linking, adducts, etc.,...please intuitively explain what is happening and where and the effects of it. For example, I know that CS2 reacts with amide and sulfhydryl groups on proteins, but what proteins exactly and where are they located?arrow_forward
- What is the standard free energy change (in kJ/mole) of the spontaneous reaction between Oxygen and NADH to form H2O2 and NAD+?arrow_forwardRedox Chemistry: Give standard free energy changes expected for the following reactions:-Succinate -> fumarate (using FAD/FADH2)-Oxaloacetate -> Malate (using NAD/NADH)-NADH --> NAD+ (using FMN/FMNH2)-CoQ --> CoQH2 (using Cytochrome C)arrow_forwardGive examples of balanced redox reactions that match the following:-Catabolic-Anabolic-Oxidative-Reductivearrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON





