
Concept explainers
To determine: The sequences of the mature RNA.
Concept introduction: The sequence of the three mRNA
Given: The sequence of the sense strand of a mammalian gene is as follows:
TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT
Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.
To determine: The sequences of encoded protein.
Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG.
Given: The sequence of the sense strand of a mammalian gene is as follows:
TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT
Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.

Trending nowThis is a popular solution!

Chapter 27 Solutions
Fundamentals of Biochemistry: Life at the Molecular Level
- 17. Which one of the compounds below is the major organic product obtained from the following series of reactions? CI benzyl alcohol OH PBr3 Mg 1. CO2 SOCl2 ? ether 2. H+, H₂O CI Cl HO OH CI Cl A B C D Earrow_forward14. What is the IUPAC name of this compound? A) 6-hydroxy-4-oxohexanenitrile B) 5-cyano-3-oxo-1-pentanol C) 5-cyano-1-hydroxy-3-pentanone D) 1-cyano-5-hydroxy-3-pentanone E) 5-hydroxy-3-oxopentanenitrile HO. CNarrow_forward13. What is the IUPAC name of this compound? A) 5-hydroxy-3,3-dimethylpentanoic acid B) 3,3-dimethylpentanoic acid C) 3,3-dimethyl-1-oxo-1,5-pentanediol D) 1,5-dihydroxy-3,3-dimethylpentanal E) 4-hydroxy-2,2-dimethylbutanoic acid HO OHarrow_forward
- Help me understand how carbon disulfide leads to toxicity in the brain, using terms like distal axonopathy, neurofilaments, covalent cross-linking, adducts, etc.,...please intuitively explain what is happening and where and the effects of it. For example, I know that CS2 reacts with amide and sulfhydryl groups on proteins, but what proteins exactly and where are they located?arrow_forwardWhat is the standard free energy change (in kJ/mole) of the spontaneous reaction between Oxygen and NADH to form H2O2 and NAD+?arrow_forwardRedox Chemistry: Give standard free energy changes expected for the following reactions:-Succinate -> fumarate (using FAD/FADH2)-Oxaloacetate -> Malate (using NAD/NADH)-NADH --> NAD+ (using FMN/FMNH2)-CoQ --> CoQH2 (using Cytochrome C)arrow_forward
- Give examples of balanced redox reactions that match the following:-Catabolic-Anabolic-Oxidative-Reductivearrow_forwardIf there are 20uM of a GLUT2 transporter on the surface of a cell, each able to move 8 per second, and 50mM glucose outside of the cell, what is the flux into the cell in mM/sec?arrow_forwardA transporter is responsible for antiporting calcium and glucose. The transporter brings glucose into the cell and sends calcium out of the cell. If blood [calcium] = 2.55mM and intracellular [calcium] = 7uM, blood [glucose] = 5.2mM, and intracellular [glucose] = 40uM, what is the free energy of transport? Assume a membrane potential of 62mV (negative inside).arrow_forward
- An ATP-coupled transporter is used to import 1 phosphate from the extracellular environment. Intracellular phosphate exists at 65mM, while it is 2mM outside.Assume a free energy change of ATP hydrolysis of -42.7 kJ/mol. What is the net free energy change of the coupled reaction? Assume a membrane potential of 70mV.arrow_forwardAnother transporter brings 3 chloride ions into the cell. Outside, chloride has a concentration of 107mM, and 4mM inside the cell. Assuming a membrane potential of 62mV (negative inside), what is the free energy of transport of these ions?arrow_forwardFor the Oxaloacetate -> Malate reaction, assume the normal ratio of NAD/NADH, what is the maximum ratio of Malate/Oxaloacetate that will allow reaction progress?arrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON





