Fundamentals of Biochemistry: Life at the Molecular Level
Fundamentals of Biochemistry: Life at the Molecular Level
5th Edition
ISBN: 9781118918401
Author: Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher: WILEY
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 27, Problem 24CQ
Summary Introduction

To determine: The sequences of the mature RNA.

Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG.

Given: The sequence of the sense strand of a mammalian gene is as follows:

TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT

Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.

Summary Introduction

To determine: The sequences of encoded protein.

Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG.

Given: The sequence of the sense strand of a mammalian gene is as follows:

TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT

Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.

Blurred answer
Students have asked these similar questions
12. When glutamic acid is heated to 180°C., it loses a molecule of water to form a lactam. The bond that creates the lactam is an amide bond that forms between the amino nitrogen and the carbon of the side chain -COOH group. What is the most reasonable structure for this lactam? (NOTE: The structure of glutamic acid is shown in Question 1.) COOH COOH ا کچھ جو کچھ C D COOH B COOH E COOH
10. Which one of the following compounds is the major organic product of the series of reactions shown here? Ph A OH Ph B CO₂Et Br -H Ν ΚΑ CO₂Et 1. NaOEt 1. NaOH, H₂O 2. H3O+ 2. PhCH2CH2Br 3. heat NH2 Ph OH NH2 0 OH Ph OH NH2 Ph D NH2 E OH
1. What is the isoelectric point of glutamic acid? (Glutamic acid has pKa1 2.10, pKa2 4.07, pKaз 9.47) A) pH 2.1 D) pH 6.8 B) pH 3.1 C) pH 4.1 E) pH 9.5 HO NH2 Glutamic acid (shown without charges) OH
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Text book image
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Text book image
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Text book image
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY