Concept explainers
Why are protists considered paraphyletic?
a. They include many extinct forms, including lineages that no longer have any living representatives.
b. They include some but not all descendants of their most recent common ancestor.
c. They represent all of the descendants of a single common ancestor.
d. Not all protists have all of the synapomorphies that define the Eukarya, such as a nucleus.

Introduction:
A protist refers to any eukaryotic organism that has a cell with distinct nucleic acids and other membrane-covered structures. They do not form a clade or a natural group.
Answer to Problem 1TYK
Correct answer:
Therefore, protists are considered paraphyletic as this organism group includes only the most recent common ancestors as their descendants.
Explanation of Solution
Explanation/justification for the correct answer:
Option (b) is given as the protists include only some descendants of their recent common ancestors. The protists are the unicellular eukaryotes. This group of organisms is simple, but very diverse. These organisms do not have common ancestors. They possess different cellular structures, varying life cycles as well as different locomotion modes. They possess characteristics of plants or animals or both. Hence, Option (b) is correct.
Explanation for incorrect answer:
Option (a) is given as they involve extinct forms including the lineages that do not have any living representatives. After studying different protists at the molecular level, it has been found that they do not have common ancestors. The protists have characteristics of the descendants of some of their recent common ancestors. So, it is a wrong answer.
Option (c) is given as they show all the descendants of a single common ancestor. The taxa, which represents the protists does not include all descendants of all of their ancestors. This means that they are paraphyletic and not monophyletic. So, it is a wrong answer.
Option (d) is given as not all protists consist of synapomorphies, which describe the eukarya like the nucleus. Therefore, the protists are paraphyletic because they include only some descendants of a single common ancestor. They do not include lineages that no longer have any living representatives. The protists are those eukaryotes that are neither animals, plants, nor fungi, but they all possess a well-defined nucleus. So, it is a wrong answer.
Hence, options (a), (c), and (d) are incorrect.
Therefore, it can be concluded that the protists are known as paraphyletic because they involve some descendants of their recent common ancestor.
Want to see more full solutions like this?
Chapter 27 Solutions
Biological Science (7th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax




