Campbell Biology (10th Edition)
10th Edition
ISBN: 9780321775658
Author: Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 26.4, Problem 1CC
Explain how comparing proteins of two species can yield data about the species' evolutionary relationship.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Explain the following phrase: Degrees of molecular similarity correlate to degrees of species relatedness.
Explain how it is possible for evolution to result in unity amongdifferent species yet also produce amazing diversity.
Provide details of a mechanism that can result in the creation of new genes, with novel functions, that may contribute to the evolution of new species. Give a specific example.
Chapter 26 Solutions
Campbell Biology (10th Edition)
Ch. 26.1 - VISUAL SKILLS: Which levels of the classification...Ch. 26.1 - Prob. 2CCCh. 26.1 - Prob. 3CCCh. 26.2 - Decide whether each of the following pairs of...Ch. 26.2 - Prob. 2CCCh. 26.3 - Prob. 1CCCh. 26.3 - Prob. 2CCCh. 26.3 - WHAT IF? Draw a phylogenetic tree that includes...Ch. 26.4 - Explain how comparing proteins of two species can...Ch. 26.4 - WHAT IF? Suppose gene A is orthologous in species...
Ch. 26.4 - Prob. 3CCCh. 26.5 - What is a molecular clock? What assumption...Ch. 26.5 - Prob. 2CCCh. 26.5 - WHAT IF? Suppose a molecular dock dates the...Ch. 26.6 - Why is the kingdom Monera no longer considered a...Ch. 26.6 - Prob. 2CCCh. 26.6 - Prob. 3CCCh. 26 - Humans and chimpanzees are sister species. Explain...Ch. 26 - Why is it necessary to distinguish homology from...Ch. 26 - Prob. 26.3CRCh. 26 - When reconstructing phylogenies, is it more useful...Ch. 26 - Prob. 26.5CRCh. 26 - Prob. 26.6CRCh. 26 - In a comparison of birds and mammals, the...Ch. 26 - To appiy parsimony to constructing a phylogenetic...Ch. 26 - VISUAL SKILLS In Figure 26.4, which similarly...Ch. 26 - Three living species X, Y, and Z share a common...Ch. 26 - Prob. 5TYUCh. 26 - If you were using cladistics to build a...Ch. 26 - VISUAL SKILLS The relative lengths of the frog and...Ch. 26 - EVOLUTION CONNECTION Darwin suggested looking at a...Ch. 26 - SCIENTIFIC INQUIRY DRAW IT (a) Draw a...Ch. 26 - WRITE ABOUT A THEME: INFORMATION In a Short essay...Ch. 26 - SYNTHESIZE YOUR KNOWLEDGE This West Indian manatee...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Study the sequences below. Construct a molecular cladogram from the different amino acid sequences given. Assume that the sequences are already compared between species and have been aligned as shown. Species 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 ACT G G C G AT C G 1 2 3 4 5 A C A G ACT G C G C G C T T C G T T C G T C G C A T C G T A C G A C G A C T G C C G T T C G C A T C G T A C G A C T G GAA C G GATC GA C G A T C G C A T C G т A C Garrow_forwardExplain how mitochondrial DNA and chloroplast DNA provide evidence for relationships between organisms of different species.arrow_forwardAsaparrow_forward
- A researcher studying two species (species 1 and species 2) sequences a short stretch of eight codons from the same gene, gene B, in each and compares them. Species 1 and species 2 had a most recent common ancestor 50 million years ago. Species 1: ATC GGG CGG GAC TTA CTA TAT GCC Species 2: ATT GGG CGG GAC TTG CTA TAT GCC Given the differences between the sequences of the two species' genes shown here, what evolutionary force can you predict is most likely in operation on gene B?arrow_forwardIn the evolution of a new variant, explain the roles of genomic cytoplasmic gene factors, ecological variation, geographical isolation, climate change, hybridization and polypliodization.arrow_forwardUse the DNA-DNA hybridization data from species A, B, C, D, and E showing the % difference in DNA between each species to answer the question that follows: D E C Species B A 4 3 3 2 X 4 3 3 B X 2 4 1 C 3 X 3 4 X D 3 1 3 X 4 E 4 4 4 23. Which of the following phylogenetic trees correctly illustrates the relationships between species A, B, C, D, and E? (assume that the letters run in sequence A-B-C-D-E at the ends of the branches) a. b. C. ABCDE ABCDE A B C D E V NY VV ABCDE 30+30+30+30)arrow_forward
- Imagine you are studying two eukaryotic species. The genome of Species A is 100 Mb in size. The genome of Species B is 500 Mb in size. Based only on this information, which of the following statements are accurate? Species B is a more complex organism than Species A. None of the other statements can be made based solely on the information in the question. Species B has more genes than Species A. Species B has more chromosomes, more genes, and is more complex than Species A. Species B has more chromosomes than Species A.arrow_forwardExplain why, from an evolutionary standpoint, the ability of an organism to recognize members of its own species developsarrow_forwardThe table below shows short DNA sequences from a gene in a closely related group of dragons, as well as their close relative, the Winged Ground Lizard. Assume each change in the DNA sequence evolved only once. Draw a phylogenetic tree that represents the relationship among the dragon species, as well as the Winged Ground Lizard. Indicate the locations on the tree where there is a change in the DNA sequence and indicate the site position and what the change isarrow_forward
- Next fill out the following table noting how many derived traits are shared for each pair of ingroup species. Species A Species B Species C Species D Species E Species F Species A Species B X X Species C X X X Species D X Species E X X Species F X X X X Use the above matrix to draw a cladogram depicting the phylogenetic relationships among all seven species. Start by grouping the pairs that have the most shared derived traits and then linking groups together. This is difficult to describe so look at the example matrix and cladogram below and then just give it a try, and ask for help if you get stuck. We will go through this as a group before lab is over to make sure everyone understands. Look at the hypothetical example first. Phylogenetic Systematics Page 5 Example Matrix Of Shared Derived Traits: Species Species Species Species A В C D Species A Species B Species C Species D 1 1 3 X Building a cladogram from above matrix: Step 1. Species C and D share the most derived traits so link…arrow_forwardThe biological species concept is based on the assumption that species are reproductively isolated and do not share genes. And yet a number of organisms that are considered different species hybridize (mate and exchange genes). Hybridization between different species is more common in plants than in animals. Propose some possible reasons for this difference.arrow_forwardFrom the DNA sequence data for the eight species (A through H) shown below, what is the genetic distance between Species A and Species C? O 4 5 6 1 O 7 2 3 4 Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAG ACT Species B ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAGACT Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT E Species Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT 5 6 7arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License