
Concept explainers
To determine:
The way in which bacteria generate new gene combinations in the absence of sexual reproduction.
Introduction:
Beneficial genes are transferred in bacterial cells through horizontal gene transfer. The genomes in the bacteria constantly show reshaping. The transfer of gene horizontally from one bacterial cell to another is through viruses.

Explanation of Solution
Pictorial representation:
Fig.1: Horizontal gene transfer in bacteria.
Explanation:
As the eukaryotes are not able to produce genetic diversity through sexual reproduction, bacteria have special mechanisms of gene transfer. Through DNA, the bacteria are able to add or subtract the gene. There are three methods of gene transfer in bacteria without sexual reproduction, which are as follows:
- 1. Conjugation: The DNA is transferred from the donor bacterial cell to the recipient bacterial cell through a structure known as pilus. The pilus connects the donor cell with the recipient cell and brings them together. As the cells become close to each other, the DNA is transferred through a small opening to the recipient bacterial cell.
- 2. Transformation: The dead bacterial cell releases its DNA in the environment. The DNA from the environment is then taken up by another bacterial cell known as recipient bacterial cell. Here, no connection is made between the donor and the recipient cell. By using transformation, many of the harmless cells can also be converted into virulent strains.
- 3. Transduction: The process of horizontal gene transfer by means of viruses in the bacterial cell is known as transduction. In transduction, the bacteriophages play an important role, as they act as viruses which help in the transfer of DNA in the recipient bacterial cell.
When the DNA leaves the donor bacterial cell, it is packaged in the form of protein capsules in the viruses, which are directly released into the recipient bacterial cell. The release of DNA into the recipient cell is done when the viruses infect the cell.
Gene transfer in bacteria includes the mechanisms of conjugation, transformation and transduction.
Want to see more full solutions like this?
Chapter 26 Solutions
Biology: How Life Works - Standalone book
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





