
Anatomy & Physiology: The Unity of Form and Function
9th Edition
ISBN: 9781260791563
Author: Kenneth S. Saladin
Publisher: Mcgraw-hill Higher Education (us)
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 25.2, Problem 4AYLO
Summary Introduction
To discuss:
Anatomy and functions of the tongue; what forms the border between the body and the root of the tongue; its intrinsic and extrinsic muscles; the lingual glands and lingual tonsils.
Introduction:
The tongue is bulky and muscular, it moves easily and quickly. It is one of the sense organs. The surface of the tongue is covered by non-keratinized squamous epithelial cells and displays projections and bumps called the lingual papillae, which is the taste bud’s site. It skillfully controls the food between the teeth without being bitten.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 25 Solutions
Anatomy & Physiology: The Unity of Form and Function
Ch. 25.1 - Prob. 1BYGOCh. 25.1 - Prob. 2BYGOCh. 25.1 - Prob. 3BYGOCh. 25.1 - Prob. 4BYGOCh. 25.1 - Prob. 1AYLOCh. 25.1 - The difference between the digestive tract and the...Ch. 25.1 - Prob. 3AYLOCh. 25.1 - Prob. 4AYLOCh. 25.1 - Prob. 5AYLOCh. 25.1 - Prob. 6AYLO
Ch. 25.2 - Prob. 5BYGOCh. 25.2 - Prob. 6BYGOCh. 25.2 - Prob. 7BYGOCh. 25.2 - Prob. 8BYGOCh. 25.2 - Prob. 9BYGOCh. 25.2 - Seven functions of the oral cavityCh. 25.2 - Prob. 2AYLOCh. 25.2 - Prob. 3AYLOCh. 25.2 - Prob. 4AYLOCh. 25.2 - Anatomy of the hard and soft palates; the two...Ch. 25.2 - Prob. 6AYLOCh. 25.2 - Six functions of saliva; its composition and pH;...Ch. 25.2 - Prob. 8AYLOCh. 25.2 - Prob. 9AYLOCh. 25.2 - The physiology of swallowing; the swallowing...Ch. 25.3 - Prob. 10BYGOCh. 25.3 - Prob. 11BYGOCh. 25.3 - Prob. 12BYGOCh. 25.3 - Prob. 13BYGOCh. 25.3 - Anatomy and functions of the stomach; features...Ch. 25.3 - Prob. 2AYLOCh. 25.3 - Prob. 3AYLOCh. 25.3 - Prob. 4AYLOCh. 25.3 - The cells that secrete hydrochloric acid, how they...Ch. 25.3 - Prob. 6AYLOCh. 25.3 - Prob. 7AYLOCh. 25.3 - Prob. 8AYLOCh. 25.3 - Prob. 9AYLOCh. 25.3 - Prob. 10AYLOCh. 25.3 - Prob. 11AYLOCh. 25.3 - The degree of digestion that occurs in the...Ch. 25.3 - Prob. 13AYLOCh. 25.3 - Prob. 14AYLOCh. 25.4 - Prob. 14BYGOCh. 25.4 - Prob. 15BYGOCh. 25.4 - Prob. 16BYGOCh. 25.4 - Prob. 17BYGOCh. 25.4 - Prob. 1AYLOCh. 25.4 - Prob. 2AYLOCh. 25.4 - Prob. 3AYLOCh. 25.4 - Prob. 4AYLOCh. 25.4 - Prob. 5AYLOCh. 25.4 - Prob. 6AYLOCh. 25.4 - Prob. 7AYLOCh. 25.4 - Composition and digestive functions of pancreatic...Ch. 25.4 - Prob. 9AYLOCh. 25.5 - Prob. 18BYGOCh. 25.5 - Prob. 19BYGOCh. 25.5 - Distinguish between segmentation and the migrating...Ch. 25.5 - Structures that mark the beginning and end of the...Ch. 25.5 - Prob. 2AYLOCh. 25.5 - Prob. 3AYLOCh. 25.5 - Prob. 4AYLOCh. 25.5 - Prob. 5AYLOCh. 25.5 - Prob. 6AYLOCh. 25.6 - What three classes of nutrients are most abundant?...Ch. 25.6 - Prob. 22BYGOCh. 25.6 - Prob. 23BYGOCh. 25.6 - Prob. 24BYGOCh. 25.6 - Prob. 25BYGOCh. 25.6 - Prob. 1AYLOCh. 25.6 - Prob. 2AYLOCh. 25.6 - Prob. 3AYLOCh. 25.6 - Prob. 4AYLOCh. 25.6 - Prob. 5AYLOCh. 25.6 - Prob. 6AYLOCh. 25.6 - Prob. 7AYLOCh. 25.6 - Differences between emulsification droplets,...Ch. 25.6 - Prob. 9AYLOCh. 25.6 - Prob. 10AYLOCh. 25.6 - Prob. 11AYLOCh. 25.7 - Prob. 26BYGOCh. 25.7 - Prob. 27BYGOCh. 25.7 - Prob. 28BYGOCh. 25.7 - Prob. 1AYLOCh. 25.7 - Prob. 2AYLOCh. 25.7 - Prob. 3AYLOCh. 25.7 - Mechanisms of the intrinsic and parasympathetic...Ch. 25 - Prob. 1TYRCh. 25 - Prob. 2TYRCh. 25 - Prob. 3TYRCh. 25 - Prob. 4TYRCh. 25 - Prob. 5TYRCh. 25 - All of the following contribute to the absorptive...Ch. 25 - Which of the following is a periodontal tissue? a....Ch. 25 - Prob. 8TYRCh. 25 - Prob. 9TYRCh. 25 - Prob. 10TYRCh. 25 - Cusps are a feature of the ______ surfaces of the...Ch. 25 - Prob. 12TYRCh. 25 - Prob. 13TYRCh. 25 - Prob. 14TYRCh. 25 - Nervous stimulation of gastrointestinal activity...Ch. 25 - Prob. 16TYRCh. 25 - Prob. 17TYRCh. 25 - Prob. 18TYRCh. 25 - Prob. 19TYRCh. 25 - Prob. 20TYRCh. 25 - Prob. 1BYMVCh. 25 - Prob. 2BYMVCh. 25 - -elleCh. 25 - Prob. 4BYMVCh. 25 - Prob. 5BYMVCh. 25 - Prob. 6BYMVCh. 25 - Prob. 7BYMVCh. 25 - porto-Ch. 25 - Prob. 9BYMVCh. 25 - Prob. 10BYMVCh. 25 - Prob. 1WWTSCh. 25 - Prob. 2WWTSCh. 25 - Prob. 3WWTSCh. 25 - Prob. 4WWTSCh. 25 - Lipids enter the circulation when the intestinal...Ch. 25 - Prob. 6WWTSCh. 25 - Prob. 7WWTSCh. 25 - Prob. 8WWTSCh. 25 - Prob. 9WWTSCh. 25 - Prob. 10WWTSCh. 25 - Prob. 1TYCCh. 25 - Prob. 2TYCCh. 25 - What do carboxypeptidase and aminopeptidase have...Ch. 25 - What do micelles and chylomicrons have in common?...Ch. 25 - Explain why most dietary lipids must be absorbed...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:CengageMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningCardiopulmonary Anatomy & PhysiologyBiologyISBN:9781337794909Author:Des Jardins, Terry.Publisher:Cengage Learning,
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Cardiopulmonary Anatomy & Physiology
Biology
ISBN:9781337794909
Author:Des Jardins, Terry.
Publisher:Cengage Learning,
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Anatomical Position And Directional Terms - Anatomical Terms - Directional Terms Anatomy; Author: Whats Up Dude;https://www.youtube.com/watch?v=pQUMJ6Gh9Bw;License: Standard YouTube License, CC-BY