
Concept explainers
To identify:
Whether the shown micrograph is a section of a root or stem.
Introduction:
The one function of the stem in plants is to provide support and another function of it to provide the position to leaves for photosynthesis. The function of roots in a plant is the transportation of water and minerals, storage and food (in some plants) and it anchors it in the soil.
To determine:
Whether the given micrograph is showing the cross-section of a monocot or eudicot.
Introduction:
Inside a seed, within its embryo, a seed leaf is present that is known as cotyledon. The embryo of some plant’s seed has only one cotyledon, they are categorized as monocots. The examples of monocot seeds are rice, wheat and so on. Eudicots are the flowering plants in which seeds have two seed leaves.

Want to see the full answer?
Check out a sample textbook solution
Chapter 25 Solutions
EBK BIOLOGY: CONCEPTS AND APPLICATIONS
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning


