To review:
The significance of immune complex formation in infective endocarditis.
Introduction:
Endocarditis refers to the disease of heart that includes heart valves and the inner surface of the heart. It is the inflammation in the inner layer of the heart, the endocardium, and thus the name endocarditis. Based on the occurrence and non-occurrence of inflammation by microorganism causing it, it is divided into two types: infective and non- infective.

Explanation of Solution
Infective endocarditis is the inflammation of the endocardium layer of the heart and heart valve by the microorganism. It is also known as subacute bacterial endocarditis when caused by the bacterial infection (SBE). People with SBE often have a high level of antibodies in their serum against the infective bacteria, this leads to the formation of immune complexes. Immune complexes are formed when antibodies bind to the antigen, these complexes can settle in kidney and joints and activates the complement system causing destruction through inflammation. The immune complexes formed in endocarditis lodge in the skin, eyes and other body parts and trigger the inflammatory response causing a greater damage to organs.
Therefore, it is concluded that the formation of the immune complex during the endocarditis leads to the destructive inflammation of organs.
Want to see more full solutions like this?
Chapter 25 Solutions
NESTER'S MICROBIOLOGY-CONNECT >CUSTOM<
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning

