
EBK BIOLOGY
10th Edition
ISBN: 8220100474729
Author: Martin
Publisher: Cengage Learning US
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 25, Problem 15TYU
Summary Introduction
To determine: The way in which the use of antibiotics imposes selective pressure on bacteria.
Introduction: A drug could be effective against a wide range of pathogens or to a narrow range of pathogens. The spectrum of action determines the range to which a drug could act on pathogens. Pathogens sometimes acquire resistance to one or more than one type of antibiotics.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 25 Solutions
EBK BIOLOGY
Ch. 25.1 - Describe the structure and common shapes of...Ch. 25.1 - Prob. 2LOCh. 25.1 - Prob. 3LOCh. 25.1 - Prob. 1CCh. 25.1 - Prob. 2CCh. 25.1 - Prob. 3CCh. 25.2 - Describe asexual reproduction in prokaryotes and...Ch. 25.2 - State specific factors that contribute to the...Ch. 25.2 - Prob. 1CCh. 25.2 - Prob. 2C
Ch. 25.2 - Prob. 3CCh. 25.3 - Describe the principal modes by which prokaryotes...Ch. 25.3 - Prob. 1CCh. 25.3 - Prob. 2CCh. 25.3 - Prob. 3CCh. 25.4 - Compare characteristics of the three domains:...Ch. 25.4 - Prob. 8LOCh. 25.4 - Prob. 9LOCh. 25.4 - Prob. 1CCh. 25.4 - Prob. 2CCh. 25.5 - Prob. 10LOCh. 25.5 - Prob. 11LOCh. 25.5 - Prob. 1CCh. 25.5 - Prob. 2CCh. 25.5 - Prob. 3CCh. 25.5 - Prob. 4CCh. 25.6 - Prob. 12LOCh. 25.6 - Prob. 13LOCh. 25.6 - Prob. 1CCh. 25.6 - Prob. 2CCh. 25 - Peptidoglycan is a chemical compound found in the...Ch. 25 - Bacterial flagella (a) are homologous with...Ch. 25 - Prob. 3TYUCh. 25 - In conjugation, (a) two bacterial cells of...Ch. 25 - The majority of heterotrophic bacteria are (a)...Ch. 25 - Bacteria that are autotrophs (a) do not require...Ch. 25 - Bacteria that thrive in puncture wounds are likely...Ch. 25 - Which of the following do not belong to domain...Ch. 25 - Prob. 9TYUCh. 25 - Robert Koch (a) proposed a set of guidelines to...Ch. 25 - Which group of bacteria contains the...Ch. 25 - VISUALIZE Label the diagram.Ch. 25 - Prob. 13TYUCh. 25 - What would be the consequences for eukaryotes if...Ch. 25 - Prob. 15TYUCh. 25 - Prob. 16TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Endosymbiotic Theory; Author: Amoeba Sisters;https://www.youtube.com/watch?v=FGnS-Xk0ZqU;License: Standard Youtube License