ANATOMY&PHYSIOLOGY: INTERACTIVE ACCESS
4th Edition
ISBN: 9781266194610
Author: McKinley
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 24.2, Problem 4WDYL
What are the regions of the kidney that drain urine?
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
hoose a scientist(s) and research their contribution to our
derstanding of DNA structure or replication. Write a one page
port and include:
their research
where they studied and the time period in which they worked
their experiments and results
the contribution to our understanding of DNA
cientists
Watson & Crick
7. Aerobic respiration of a protein that breaks down into 12 molecules of malic acid. Assume there is no
other carbon source and no acetyl-CoA.
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
3
For each of the following problems calculate the following: (Week 6-3 Video with 6-1 and 6-2)
Consult the total catabolic pathways on the last page as a reference for the following questions.
A. How much NADH and FADH2 is produced and fed into the electron transport chain (If any)?
B. How much ATP is made from oxidative phosphorylation (OP), if any? Feed the NADH and FADH2 into the
electron transport chain: 3ATP/NADH, 2ATP/FADH2
C. How much ATP is made by substrate level phosphorylation (SLP)?
D. How much total ATP is made? Add the SLP and OP together.
1. Aerobic respiration using 0.5 mole of glucose?
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
Chapter 24 Solutions
ANATOMY&PHYSIOLOGY: INTERACTIVE ACCESS
Ch. 24.1 - Which structure of the urinary system forms urine,...Ch. 24.1 - What are the two means by which the kidney helps...Ch. 24.2 - What tissue composes the fibrous capsule that...Ch. 24.2 - What are the regions of the kidney that drain...Ch. 24.2 - What three anatomic structures of the kidney are...Ch. 24.3 - Prob. 6WDYLCh. 24.3 - Prob. 7WDYLCh. 24.3 - Prob. 8WDYLCh. 24.3 - Differentiate between the function of principal...Ch. 24.3 - What are the two primary cellular components of...
Ch. 24.4 - Prob. 11WDYLCh. 24.4 - What are the three major types of capillaries...Ch. 24.4 - What is the pathway of fluid filtered by the...Ch. 24.5 - How does tubular reabsorption differ from tubular...Ch. 24.5 - How are the components of the filtration membrane...Ch. 24.5 - What is normally filtered across the glomerular...Ch. 24.5 - Prob. 17WDYLCh. 24.5 - What is the value of the NFP if the glomerular...Ch. 24.5 - Prob. 19WDYLCh. 24.5 - If HPg increases, what is the effect on NFP? Is...Ch. 24.5 - Does urine production increase, decrease, or stay...Ch. 24.5 - What are the three factors that regulate...Ch. 24.5 - Prob. 23WDYLCh. 24.6 - What are the significant anatomic and physiologic...Ch. 24.6 - What is the transport maximum of a substance? How...Ch. 24.6 - Prob. 26WDYLCh. 24.6 - Why are proteins said to be transported rather...Ch. 24.6 - How does Na+ reabsorption occur? Which two...Ch. 24.6 - What is the effect of parathyroid hormone on the...Ch. 24.6 - How is the movement of H+ and HCO3 regulated by...Ch. 24.6 - Prob. 31WDYLCh. 24.6 - Prob. 32WDYLCh. 24.6 - Prob. 33WDYLCh. 24.7 - Prob. 34WDYLCh. 24.7 - Prob. 35WDYLCh. 24.8 - Prob. 36WDYLCh. 24.8 - Prob. 37WDYLCh. 24.8 - Prob. 38WDYLCh. 24.8 - Prob. 39WDYLCh. 24 - Prob. 1DYKBCh. 24 - _____ 2. When the kidneys are described as being...Ch. 24 - _____ 3. Which of the following is located within...Ch. 24 - _____ 4. All of the following are capillaries...Ch. 24 - _____ 5. Which of the following is a component of...Ch. 24 - _____ 6. If blood pressure in the glomerulus...Ch. 24 - _____ 7. Which hormone increases Na+ and water...Ch. 24 - _____ 8. If the tubular maximum is exceeded, then...Ch. 24 - _____ 9. The function unique to the nephron loop...Ch. 24 - _____ 10. If antidiuretic hormone (ADH)...Ch. 24 - Trace blood flow into and out of the kidney....Ch. 24 - Describe where filtrate, tubular fluid, and urine...Ch. 24 - Describe the anatomic components of the...Ch. 24 - Prob. 14DYKBCh. 24 - Explain how glomerular filtration rate (GFR) is...Ch. 24 - Discuss the affect of aldosterone and antidiuretic...Ch. 24 - Explain how antidiuretic hormone (ADH) is...Ch. 24 - Describe the significant differences between blood...Ch. 24 - Identify all of the following that are functions...Ch. 24 - Explain the process of micturition.Ch. 24 - Use the following paragraph to answer questions...Ch. 24 - Prob. 2CALCh. 24 - Use the following paragraph to answer questions...Ch. 24 - Martin, a young man of 20, was in a car accident...Ch. 24 - A 19-year-old male named Paul was in a diving...Ch. 24 - A patient with cancer is treated with...Ch. 24 - Prob. 2CSLCh. 24 - Males who suffer from either benign prostatic...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Aerobic respiration of one lipid molecule. The lipid is composed of one glycerol molecule connected to two fatty acid tails. One fatty acid is 12 carbons long and the other fatty acid is 18 carbons long in the figure below. Use the information below to determine how much ATP will be produced from the glycerol part of the lipid. Then, in part B, determine how much ATP is produced from the 2 fatty acids of the lipid. Finally put the NADH and ATP yields together from the glycerol and fatty acids (part A and B) to determine your total number of ATP produced per lipid. Assume no other carbon source is available. 18 carbons fatty acids 12 carbons glycerol . Glycerol is broken down to glyceraldehyde 3-phosphate, a glycolysis intermediate via the following pathway shown in the figure below. Notice this process costs one ATP but generates one FADH2. Continue generating ATP with glyceraldehyde-3-phosphate using the standard pathway and aerobic respiration. glycerol glycerol-3- phosphate…arrow_forwardDon't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forward
- Biology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forwardWrite the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forward
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Excretory System; Author: Amoeba Sisters;https://www.youtube.com/watch?v=q5qaGHfdmYM;License: Standard youtube license