ANAT.+PHYSIO.1-LAB.MAN. >CUSTOM<
20th Edition
ISBN: 9781264303106
Author: VanPutte
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Question
Chapter 24, Problem 6CT
Summary Introduction
To determine:
The ways by which increased chloride channels are responsible for causing severe diarrhea and its decrease activity results in cystic fibrosis.
Introduction:
Vibrio cholerae is a bacterium that is responsible for producing cholera toxin. This toxin activates the chloride channels that are present in the intestinal epithelium.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 24 Solutions
ANAT.+PHYSIO.1-LAB.MAN. >CUSTOM<
Ch. 24.1 - Prob. 1AYPCh. 24.2 - Describe each of the functions involved in the...Ch. 24.2 - Prob. 3AYPCh. 24.2 - What is the difference between mechanical...Ch. 24.2 - What digestive functions occur in the stomach? In...Ch. 24.3 - What are the major tunics of the digestive tract...Ch. 24.3 - What types of tissue are found in each tunic?Ch. 24.3 - In what tunics of the digestive tract are the...Ch. 24.3 - How do the serosa and adventitia differ?Ch. 24.4 - Prob. 10AYP
Ch. 24.4 - What chemical mechanisms regulate the digestive...Ch. 24.5 - Where are the viscera/ peritoneum and parietal...Ch. 24.5 - Prob. 13AYPCh. 24.5 - What are the mesenteries? Name and describe the...Ch. 24.6 - Prob. 15AYPCh. 24.6 - Prob. 16AYPCh. 24.6 - Prob. 17AYPCh. 24.6 - Prob. 18AYPCh. 24.6 - Prob. 19AYPCh. 24.6 - List the three parts of a tooth. What are dentin,...Ch. 24.6 - List the muscles of mastication and the actions...Ch. 24.6 - Name and give the location of the three largest...Ch. 24.6 - Prob. 23AYPCh. 24.6 - Prob. 24AYPCh. 24.6 - Prob. 25AYPCh. 24.6 - Name the parts of the pharynx involved with...Ch. 24.7 - Where is the esophagus located? Describe the...Ch. 24.7 - What are the three phases of swallowing?...Ch. 24.8 - Describe the parts of the stomach. List the tunics...Ch. 24.8 - Prob. 30AYPCh. 24.8 - Name the types of cells in the stomach and the...Ch. 24.8 - Describe three phases of regulation of stomach...Ch. 24.8 - How ore gastric secretions inhibited? Why is this...Ch. 24.8 - As the stomach fills, why does the pressure not...Ch. 24.8 - Name two kinds of stomach movements. How are...Ch. 24.9 - Name and describe the three parts of the small...Ch. 24.9 - What are the circular folds, villi, and microvilli...Ch. 24.9 - Name the four types of cells found in the...Ch. 24.9 - Prob. 39AYPCh. 24.9 - Prob. 40AYPCh. 24.9 - Prob. 41AYPCh. 24.9 - Prob. 42AYPCh. 24.10 - Prob. 43AYPCh. 24.10 - Diagram the duct system from the liver....Ch. 24.10 - Describe the flow of blood to and through the...Ch. 24.10 - Explain and give examples of the major functions...Ch. 24.10 - Prob. 47AYPCh. 24.11 - Prob. 48AYPCh. 24.11 - What is the function of the gallbladder? What...Ch. 24.12 - Describe the parts of the pancreas responsible for...Ch. 24.12 - Name the two kinds of exocrine secretions produced...Ch. 24.12 - What enzymes are present in pancreaticjuice?...Ch. 24.13 - Prob. 53AYPCh. 24.13 - Prob. 54AYPCh. 24.13 - Prob. 55AYPCh. 24.13 - Prob. 56AYPCh. 24.13 - Prob. 57AYPCh. 24.14 - Describe the mechanism of absorption and the route...Ch. 24.14 - Prob. 59AYPCh. 24.14 - Explain how lipids are emulsified. Describe the...Ch. 24.14 - Explain how tripeptides, dipeptides, and amino...Ch. 24.14 - Describe the movement of water through the...Ch. 24.14 - Prob. 63AYPCh. 24.15 - Prob. 64AYPCh. 24.15 - Prob. 65AYPCh. 24.15 - Prob. 66AYPCh. 24 - Which layer of the digestive tract is in direct...Ch. 24 - The ENS is found in the submucosa layer. the...Ch. 24 - Dentin forms the surface of the crown of the...Ch. 24 - The number of premolar deciduous teeth is a. 0.b....Ch. 24 - Which of these glands does not secrete saliva into...Ch. 24 - The portion of the digestive tract in which...Ch. 24 - Prob. 7RACCh. 24 - The stomach a. has large folds in the submucosa...Ch. 24 - Prob. 9RACCh. 24 - Prob. 10RACCh. 24 - Prob. 11RACCh. 24 - Prob. 12RACCh. 24 - Which cellsin the small intestine have digestive...Ch. 24 - Prob. 14RACCh. 24 - Prob. 15RACCh. 24 - The gallbladder a. produces bile. b. stores bile....Ch. 24 - Prob. 17RACCh. 24 - Prob. 18RACCh. 24 - Defecation a. can be initiated by stretch of the...Ch. 24 - Which of these structures...Ch. 24 - Prob. 21RACCh. 24 - Prob. 22RACCh. 24 - Prob. 23RACCh. 24 - Which of these lipoprotein molecules transports...Ch. 24 - Prob. 1CTCh. 24 - Prob. 2CTCh. 24 - Prob. 3CTCh. 24 - Prob. 4CTCh. 24 - A patient has a spinal cord injury at level L 2....Ch. 24 - Prob. 6CTCh. 24 - Prob. 7CTCh. 24 - Prob. 8CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human digestive system - How it works! (Animation); Author: Thomas Schwenke;https://www.youtube.com/watch?v=X3TAROotFfM;License: Standard Youtube License