ANAT.+PHYSIO.2-LAB.MAN. >CUSTOM<
20th Edition
ISBN: 9781264303090
Author: VanPutte
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 2.4, Problem 38AYP
Summary Introduction
To list:
The 5- and 6-carbon sugars that are important to humans.
Introduction:
Carbohydrates are made up of many simple building blocks known as monosaccharides. Carbohydrates mostly contain around two hydrogen atoms and one oxygen atom for each carbon atom.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Using the figure below, determine the metabolic intermediate(s) directly produced from the carbon atoms of each of the following amino acids. Check all that
apply for each part.
alanine, cysteine,
isoleucine, leucine,
Part 1 of 2
Valine
leucine, lysine,
glycine, serine,
pyruvate
threonine, tryptophan
threonine, tryptophan
phenylalanine,
tryptophan, tyrosine
acetyl CoA acetoacetyl CoA
(CH,COCH,COSCA)
asparagine,
aspartic acid
oxaloacetate
citrate
malate
isocitrate
Citric acid
cycle
phenylalanine,
tyrosine
fumarate
Part 2 of 2
Asparagine
fumarate
acetoacetyl CoA
pyruvate
oxaloacetate
succinyl CoA
a-ketoglutarate
acetyl CoA
None of the above
fumarate
acetoacetyl CoA
pyruvate
oxaloacetate
succinyl CoA
a-ketoglutarate
acetyl CoA
None of the above
a-ketoglutarate
arginine, glutamic acid,
glutamine, histidine,
proline
K
succinate
succinyl CoA
isoleucine, methionine,
threonine, valine
Please explain the 4 types of sugars and why do we need them to function
75 76
please answer all
Chapter 2 Solutions
ANAT.+PHYSIO.2-LAB.MAN. >CUSTOM<
Ch. 2.1 - Define matter. How are the mass and the weight of...Ch. 2.1 - Differentiate between element and atom. What four...Ch. 2.1 - Prob. 3AYPCh. 2.1 - Which subatomic particle determines the atomic...Ch. 2.1 - What is an isotope? How are isotopes denoted?Ch. 2.1 - What is avogardro’s number? How is it related to a...Ch. 2.1 - Describe how an ionic bond is formed. What are...Ch. 2.1 - What occurs in the formation of a covalent bond?...Ch. 2.1 - Distinguish between a molecule and a compund. Give...Ch. 2.1 - What are intermolecular forces, and how do they...
Ch. 2.1 - What is meant by the statement “table sugar is...Ch. 2.1 - Describe what occurs during the dissociation of...Ch. 2.1 - Explain the difference between electrolytes and...Ch. 2.2 - Using the terms reactant and product, describe...Ch. 2.2 - Contrast synthesis and decomposition reactions,...Ch. 2.2 - Describe the role of water in dehydration and...Ch. 2.2 - What is a reversible reaction? How does this type...Ch. 2.2 - What are oxidation-reduction reactions?Ch. 2.2 - Define energy. How are potential and kinetic...Ch. 2.2 - Summarize the characteristics of mechanical,...Ch. 2.2 - Use ATP and ADP to Illustrate the release or input...Ch. 2.2 - Define activation energy, catalyst, and enzymes;...Ch. 2.2 - What effect does increasing temperature or...Ch. 2.3 - What is the difference between inorganic and...Ch. 2.3 - What two properites of water are the result of...Ch. 2.3 - List and briefly describe the four functions that...Ch. 2.3 - Prob. 27AYPCh. 2.3 - Prob. 28AYPCh. 2.3 - Prob. 29AYPCh. 2.3 - Prob. 30AYPCh. 2.3 - Prob. 31AYPCh. 2.3 - Prob. 32AYPCh. 2.3 - Prob. 33AYPCh. 2.3 - Prob. 34AYPCh. 2.3 - What are the functions of oxygen and carbon...Ch. 2.4 - Prob. 36AYPCh. 2.4 - Prob. 37AYPCh. 2.4 - Prob. 38AYPCh. 2.4 - Prob. 39AYPCh. 2.4 - Which carbohydrates are used for energy? What is...Ch. 2.4 - Prob. 41AYPCh. 2.4 - Prob. 42AYPCh. 2.4 - Prob. 43AYPCh. 2.4 - Prob. 44AYPCh. 2.4 - Prob. 45AYPCh. 2.4 - Prob. 46AYPCh. 2.4 - What are the building blocks of proteins? What...Ch. 2.4 - Prob. 48AYPCh. 2.4 - Prob. 49AYPCh. 2.4 - Compare the lock-and-key and the induced fit...Ch. 2.4 - Prob. 51AYPCh. 2.4 - What are the basic building blocks of nucleic...Ch. 2.4 - DNA is like a twisted ladder. What forms the sides...Ch. 2.4 - Prob. 54AYPCh. 2.4 - Prob. 55AYPCh. 2.4 - Prob. 56AYPCh. 2.4 - Prob. 57AYPCh. 2 - Prob. 1RACCh. 2 - Prob. 2RACCh. 2 - Prob. 3RACCh. 2 - Prob. 4RACCh. 2 - Table salt (NaCl) is an atom organic. a molecule....Ch. 2 - Prob. 6RACCh. 2 - Prob. 7RACCh. 2 - Prob. 8RACCh. 2 - Prob. 9RACCh. 2 - Prob. 10RACCh. 2 - Prob. 11RACCh. 2 - Which of these statements concerning enzymes is...Ch. 2 - Prob. 13RACCh. 2 - Prob. 14RACCh. 2 - Prob. 15RACCh. 2 - Prob. 16RACCh. 2 - A buffer slows down chemical reactions. speeds up...Ch. 2 - Prob. 18RACCh. 2 - Prob. 19RACCh. 2 - Prob. 20RACCh. 2 - Prob. 21RACCh. 2 - Prob. 22RACCh. 2 - Prob. 23RACCh. 2 - DNA molecules conatin genes. contain a single...Ch. 2 - Prob. 25RACCh. 2 - Prob. 1CTCh. 2 - Prob. 2CTCh. 2 - A mixture of chemicals is warmed slightly. As a...Ch. 2 - Two solutions, when mixed together at room...Ch. 2 - Prob. 5CTCh. 2 - Prob. 6CTCh. 2 - Carbon dioxide that accumulates in the blood can...Ch. 2 - An enzyme (E) catalyzes the following reaction:...Ch. 2 - Using the materials commonly found in a kitchen,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Describe the types of enzymatic reactions that occur during the synthesis of N-linked oligosaccharides.arrow_forwardDefine anabolism. How does anabolism relate to energy? What role does anabolism play in YOUR body? DO NOT JUST COPY AND PASTE PLEASE.arrow_forwardconsider the active site of an enzyme. which of the following amino acids are likely to catalyze the reaction? choices A- Aspartate B-Alanine C- Valinearrow_forward
- Select all of the microbial enzymes that can form an ester bond. stomach (monogastric) small intestine large intestine abomasum reticulo-rumen liver pancreas volatile fatty acids hydrogen sink saturated fatty acids (SFA) unsaturated fatty acids (UFA) triacylglycerol (TAG) diacylglycerol (DAG) monoacylglycerol (MAG) phospholipid glycolipid microbial phospholipid (MPL) lingual lipase gastric lipase emulsification pancreatic lipase lipoprotein lipase colipase galactolipase lipase hydrogenase phospholipase bile acyl CoA synthetase lipoprotein B-48 chylomicron remnant chylomicron muscle cells adipose cells none of the abovearrow_forwardWhenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forwardpredict the function of the following enzymes: 1. cellulase 2. aspartate aminotranferasearrow_forward
- Why does it make good sense to have a single nucleotide, ATP, function as the cellular energy currency?arrow_forwardList two industrially significant enzymes.arrow_forwardHow does the presence of a-bonds versus B-bonds influence the digestibility of glucose polymers by humans?Hint: There are two effects.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College