BIOLOGY
12th Edition
ISBN: 9781264839698
Author: Raven
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 24, Problem 1S
The FOX2 gene is associated with speech in human. It is also found in chimpanzees, gorillas, orangutans, rhesus macaques, and even the mouse, yet none of these mammals speak. Develop a hypothesis that explains whyFOXP2 supports speech in humans but not other mammals.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Using a computer algorithm that searches for sequence similarities in other organisms, you discover
that hexose kinase is a highly conserved gene that is expressed by many species, both prokaryotic
and eukaryotic. The most closely related prokaryotic homolog of hexose kinase has a protein
sequence in which 90% of the amino acids are identical to those of the human version of the gene.
To learn more about their similarity at the DNA level, you obtain segments of the genomic DNA
coding for the hexose kinase gene in both humans and this prokaryotic species. After combining
both DNA samples, you heat them to denature the DNA strands and then allow them to cool and
reanneal. Finally, you examine the DNA hybrids you obtain under the electron microscope.
Your analysis reveals that there are three different DNA hybrids in this sample, these can be seen
below. You reason that one must belong to the prokaryotic species, one to the humans and the
third arose when one strand from each species base…
The phenotype of a heterozygous mouse (Aa) is agouti. The agouti banding pattern is due to altered expression of the agouti gene. Which of the following statement is false?
a) Expression of the agouti gene inhibits the production of eumelanin.
b) Evidence suggests that the agouti gene is only expressed in tissues associated with fur production.
c) Epigenetic markers silence the agouti gene resulting in dark pigmentation at the tip and root of the hair.
d) All of the above
Suppose you want to determine whether a particulargene X is important for specification of the pharynx,but mutations in this same gene disrupt embryonicdevelopment well before pharyngeal structures appear.How could you use myo-2::GFP, the myo-2 promoter,the DNA sequence of gene X, and your knowledge ofRNA interference (RNAi) to generate worms that lackgene X expression in the pharynx but express gene Xin all other tissues in which it is expressed in wildtype C. elegans?
Chapter 24 Solutions
BIOLOGY
Ch. 24.1 - Prob. 1LOCh. 24.1 - Prob. 2LOCh. 24.1 - Prob. 3LOCh. 24.2 - Prob. 1LOCh. 24.2 - Prob. 2LOCh. 24.2 - Prob. 3LOCh. 24.2 - Explain why genome size and genome number do not...Ch. 24.3 - Define the terms segmental duplication, genome...Ch. 24.3 - Prob. 2LOCh. 24.4 - Prob. 1LO
Ch. 24.4 - Prob. 2LOCh. 24.5 - Prob. 1LOCh. 24.5 - Prob. 2LOCh. 24.5 - Prob. 3LOCh. 24 - Prob. 1DACh. 24 - Prob. 1IQCh. 24 - Prob. 2IQCh. 24 - Prob. 3IQCh. 24 - Humans and pufferfish diverged from a common...Ch. 24 - Prob. 2UCh. 24 - Prob. 3UCh. 24 - Homologous genes in distantly related organisms...Ch. 24 - All of the following are believed to contribute to...Ch. 24 - What is the fate of most duplicated genes? a. Gene...Ch. 24 - Chimp and human DNA whole-genome sequences differ...Ch. 24 - Prob. 2ACh. 24 - Analyze the conclusion that the Medicago...Ch. 24 - Analyze why an herbicide that targets the...Ch. 24 - The FOX2 gene is associated with speech in human....Ch. 24 - One of the common misconceptions about sequencing...Ch. 24 - How does horizontal gene transfer (HGT) complicate...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You are working with a fly hair cell developmental system. This Notch/Delta-regulated system results in clusters of cells where the central one differentiates into a specialized hair cell. To better understand this system you have tagged the C-terminal cytoplasmic domain of Notch with GFP. You have done a forward genetic screen to look for mutants that have unusual phenotypes in this Notch system. The first one is a mutation in Notch itself. This mutant is in the ADAM10 cleavage site and blocks proteolysis. Draw the expected outcome for such a mutant: GFP localization and developmental outcome 24hr after differentiation. WT before differentiation WT 24 hours after differentiationarrow_forwardWhich specialized gene product is responsible for the fusion of mononucleated skin fibroblasts into multinucleated skeletal muscle cells in humans (a type of positive feedback in gene expression)? the glucocorticoid receptor protein the antennapedia protein the PAX-6 protein the MyoD protein the Ey proteinarrow_forwardMarilyn Houck and Margaret Kidwell proposed that P elements were carried from Drosophila willistoni to Drosophila melanogaster by mites that feed on fruit flies (M. A. Houck et al. 1991. Science 253:1125–1129). What evidence do you think would be required to demonstrate that D. melanogaster acquired P elements in this way? Propose a series of experiments to provide such evidence.arrow_forward
- Explain pleasearrow_forwardPlease asaparrow_forwardTermicin is a small antifungal protein in termites that is produced by cells and secreted into termite saliva in response to a pathogen. In vitro translation of the termicin-encoding gene is performed, and the effects of that product are compared to those of termicin extracted from a termite. You see that extracted termicin exhibits more antifungal behavior than in vitro translated termicin. After further analysis, you see that extracted termicin contains 3 disulfide bonds, while in vitro translated termicin contains zero. The addition of microsomes to the in vitro translation reaction results in termicin with all 3 disulfide bonds. What experimental condition is most likely responsible for this difference? A. in vitro translation was not performed at the correct temperature affecting protein folding B. a mutation occurred during in vitro translation, leading to differences in disulfide bond formation O C. the UPR can not be activated in vitro, therefore, this protein can only be…arrow_forward
- By integrating transcriptomic data and tandem mass spectrometer data, researchers discovered that variable peptide processing (VPP, a form of post-translational regulation) explains how 105 conopeptide precursors identified in the venom gland transcriptome can generate more than 7000 unique venom peptides in a single species of cone snail. How do these examples of -omics studies challenge your original understanding of the Central Dogma of biology? What do you think is next for the field of venomics? What could/should we be learning next? (5 points)arrow_forwardComparisons between human and chimpanzee genomes indicate that a gene that may function as a wild-type or normal gene in one primate may function as a disease-causing gene in another [The Chimpanzee Sequencing and Analysis Consortium (2005). Nature 437:69–87]. For instance, the PPARG locus (regulator of adipocyte differentiation) is a wild-type allele in chimps but is clearly associated with Type 2 diabetes in humans. What factors might cause this apparent contradiction? Would you consider such apparent contradictions to be rare or common? What impact might such findings have on the use of comparative genomics to identify and design therapies for disease-causing genes in humans?arrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forward
- If we knock out a gene, it can tell us something about how important that gene is or if other genes can compensate for its absence in a complex. To further establish the role of PSEN1 and PSEN2 in early onset Alzheimer's disease they are individually knocked out in mouse models. Knockout of PSEN1 leads to an embryonic lethal phenotype and dramatically reduced Aß levels. However knockout of PSEN2 gives no obvious phenotype and essentially normal AB levels. Question 16) Which of the following hypotheses does this observation support? [10 Marks] Under normal circumstances y-secretase complexes contain equal ratios of PSEN1 and PSEN2 b. The knockout of PSEN1 and PSEN2 didn't work O c. a. Under normal circumstances y-secretase complexes primarily contain PSEN2 rather than PSEN1 d. Under normal circumstances y-secretase complexes primarily contain PSEN1 rather than PSEN2 e. Under normal circumstances y-secretase complexes do not contain either PSEN1 or PSEN2arrow_forwardMost organisms display a circadian rhythm, a cycling of biological processes that is roughly synchronized with day length. In Drosophila, pupae eclose (emerge as adults after metamorphosis) at dawn. a)Using this knowledge how would screen for Drosophila mutants that have an impaired circadian rhythm? b)In each case, how would you clone the genes you identified by mutation?arrow_forwardMammals are anatomically and physiologically more complex than roundworms, yet both organisms have approximately the same number of genes, about 20,000. Some biologists have argued that mammals and other vertebrates have evolved increased complexity by means of pleiotropy, and that pleiotropy was made possible largely by the evolution of additional enhancers. Propose an explanation for how additional enhancers might produce increased pleiotropy. Can you find examples of this phenomenon?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY