
A.
To determine: The reason for specific tests for albumin rather than the globulins or other plasma proteins.
Introduction: Proteinuria is a condition in which excessive protein is excreted in the urine. The proteinuria is caused due to the glomerular capillary filtration barrier. A protein reagent dipstick is often used to check the presence of proteins in the urine.
A.

Explanation of Solution
The renal corpuscle or glomerulus is the main blood filtering unit of the nephron present in the kidney. It is made up of a tuft of capillaries, the central region of mesangial cells and matrix, enclosed by a capsule-like structure called Bowman capsule. There are only some specific proteins that can pass through the filters present in the kidneys. The filters may be damaged by some kidney disorder, which increases the amount of protein like albumin, immunoglobulins from the blood. The high level of albumin in the urine is used to diagnosed for any kidney dysfunction; due to its small size, it is filtered rapidly than any other plasma proteins; hence the microalbuminuria is often used for screening purposes.
B.
To determine: The physiologic rationale for strict control of blood sugars and the treatment of hypertension.
Introduction: Diabetes is a problem in which the body is unable to process blood glucose or sugar levels. The general symptoms of the disease include increased hunger and thirst, weight loss, extreme fatigue, frequent urination and many more
B.

Explanation of Solution
The blood sugar levels are responsible for maintaining due to diabetic patients as well as those with kidney disorders. The kidneys maintain the levels of glucose by filtering and reabsorbing glucose. The insulin hormone is responsible for controlling the bloo0d glucose levels in the body. The treatment of hypertension decreases the progression of kidney disorder because high blood pressure can hasten kidney failure. The lowering of blood pressure may slow down kidney diseases.
Want to see more full solutions like this?
Chapter 24 Solutions
EBK ESSENTIALS OF PATHOPHYSIOLOGY
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





