Anatomy & Physiology
3rd Edition
ISBN: 9781259398629
Author: McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher: Mcgraw Hill Education,
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 23.4, Problem 23LO
Summary Introduction
To explain: The function of serous fluid in the pleural cavity.
Concept introduction: The membrane that lines the outer surfaces of lung and the adjacent internal thoracic wall is known as the pleura. It is a serous membrane that consists of simple squamous epithelium and a thin layer of areolar connective tissue. There are two layers of pleura, namely the visceral pleura and the parietal pleura.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 23 Solutions
Anatomy & Physiology
Ch. 23.1 - Prob. 1LOCh. 23.1 - Which respiratory structure is associated with the...Ch. 23.1 - Prob. 2LOCh. 23.1 - Prob. 2WDLCh. 23.1 - LEARNING OBJECTIVE
3. Describe the structure of...Ch. 23.1 - Prob. 4LOCh. 23.1 - In what ways does the epithelium of the upper...Ch. 23.2 - Prob. 5LOCh. 23.2 - Prob. 6LOCh. 23.2 - Prob. 1WDT
Ch. 23.2 - What changes occur to inhaled air as it passes...Ch. 23.2 - What is the function of nasal conchae?Ch. 23.2 - Prob. 7LOCh. 23.2 - How are the paranasal sinuses connected to the...Ch. 23.2 - Prob. 8LOCh. 23.2 - What two regions of the pharynx contain tonsils?...Ch. 23.3 - LEARNING OBJECTIVE
9. Describe the general...Ch. 23.3 - Prob. 10LOCh. 23.3 - How does the larynx assist in increasing abdominal...Ch. 23.3 - What are the three unpaired cartilages in the...Ch. 23.3 - Prob. 10WDLCh. 23.3 - Prob. 11LOCh. 23.3 - Prob. 12LOCh. 23.3 - Prob. 2WDTCh. 23.3 - What is the function of the C-shaped tracheal...Ch. 23.3 - LEARNING OBJECTIVE
13. Describe the structural...Ch. 23.3 - Prob. 14LOCh. 23.3 - What are the significant structural differences...Ch. 23.3 - Prob. 15LOCh. 23.3 - LEARNING OBJECTIVE
16. List three types of cells...Ch. 23.3 - Which of the following respiratory structures are...Ch. 23.3 - The respiratory tract can be damaged from...Ch. 23.3 - List the conducting and respiratory structures (in...Ch. 23.3 - Prob. 17LOCh. 23.3 - List, in order, the structures of the respiratory...Ch. 23.4 - Prob. 18LOCh. 23.4 - Prob. 19LOCh. 23.4 - Match the component of the ling with its air...Ch. 23.4 - Prob. 20LOCh. 23.4 - Prob. 21LOCh. 23.4 - Prob. 18WDLCh. 23.4 - Prob. 22LOCh. 23.4 - Prob. 23LOCh. 23.4 - What is the function of serous fluid within the...Ch. 23.4 - LEARNING OBJECTIVE
24. Explain the anatomic...Ch. 23.4 - Why is the intrapleural pressure normally lower...Ch. 23.5 - Prob. 25LOCh. 23.5 - Prob. 21WDLCh. 23.5 - LEARNING OBJECTIVE
26. Explain how pressure...Ch. 23.5 - Prob. 27LOCh. 23.5 - Prob. 28LOCh. 23.5 - Describe the sequence of events of quiet...Ch. 23.5 - How are larger amounts of air moved between the...Ch. 23.5 - Prob. 29LOCh. 23.5 - Prob. 30LOCh. 23.5 - LEARNING OBJECTIVE
31. Explain the different...Ch. 23.5 - Prob. 32LOCh. 23.5 - Prob. 3WDTCh. 23.5 - Prob. 24WDLCh. 23.5 - Which of the following stimuli will cause an...Ch. 23.5 - Are the skeletal muscles of breathing innervated...Ch. 23.5 - Prob. 33LOCh. 23.5 - Prob. 34LOCh. 23.5 - Prob. 4WDTCh. 23.5 - The two factors that determine airflow are the...Ch. 23.5 - Prob. 35LOCh. 23.5 - Prob. 36LOCh. 23.5 - Prob. 5WDTCh. 23.5 - A person in yoga class is encouraged to take long,...Ch. 23.5 - Prob. 37LOCh. 23.5 - Prob. 38LOCh. 23.5 - Prob. 39LOCh. 23.5 - Prob. 29WDLCh. 23.6 - Prob. 40LOCh. 23.6 - Prob. 41LOCh. 23.6 - Prob. 42LOCh. 23.6 - Given the same partial pressure for oxygen and...Ch. 23.6 - LEARNING OBJECTIVE
43. Describe alveolar gas...Ch. 23.6 - Prob. 44LOCh. 23.6 - Prob. 45LOCh. 23.6 - How do the partial pressures of oxygen and carbon...Ch. 23.6 - Prob. 32WDLCh. 23.6 - Prob. 46LOCh. 23.6 - Prob. 47LOCh. 23.6 - Prob. 6WDTCh. 23.6 - How do the partial pressures of oxygen and carbon...Ch. 23.7 - Prob. 48LOCh. 23.7 - Why is such a small percentage (about 2%) of...Ch. 23.7 - Prob. 49LOCh. 23.7 - Prob. 50LOCh. 23.7 - How is the majority of carbon dioxide transported...Ch. 23.7 - Prob. 51LOCh. 23.7 - Prob. 52LOCh. 23.7 - Prob. 7WDTCh. 23.7 - Prob. 8WDTCh. 23.7 - How does oxygen movement occur during alveolar gas...Ch. 23.7 - How does carbon dioxide movement occur during...Ch. 23.7 - Does hemoglobin saturation increase or decrease...Ch. 23.7 - How is oxygen release from hemoglobin during...Ch. 23.8 - Prob. 53LOCh. 23.8 - Prob. 54LOCh. 23.8 - How does blood PO2 and PCO2 change if an...Ch. 23.8 - Prob. 55LOCh. 23.8 - Prob. 9WDTCh. 23.8 - How does blood PO2 and PCO2 change during...Ch. 23.8 - Prob. 42WDLCh. 23 - Prob. 1DYBCh. 23 - Prob. 2DYBCh. 23 - Prob. 3DYBCh. 23 - Prob. 4DYBCh. 23 - Prob. 5DYBCh. 23 - Which areas of the brain contain the respiratory...Ch. 23 - Prob. 7DYBCh. 23 - Prob. 8DYBCh. 23 - Prob. 9DYBCh. 23 - Prob. 10DYBCh. 23 - Explain how the respiratory tract is organized...Ch. 23 - Describe the relationship of the visceral pleura,...Ch. 23 - List the four processes of respiration, in order,...Ch. 23 - Describe the muscles, volume changes, and pressure...Ch. 23 - Explain how additional air is moved during a...Ch. 23 - Describe bow quiet breathing is controlled by the...Ch. 23 - Explain alveolar and systemic gas exchange.Ch. 23 - List the two means by which oxygen is transported...Ch. 23 - Describe the relationship of PCO2 and hemoglobin...Ch. 23 - List the variables that increase the release of...Ch. 23 - Paramedics arrived at a car accident to find an...Ch. 23 - Use the following to answer questions 24....Ch. 23 - Use the following to answer questions 24....Ch. 23 - Use the following to answer questions 24....Ch. 23 - Prob. 5CALCh. 23 - Prob. 1CSLCh. 23 - The nerve to the sternocleidomastoid muscle was...Ch. 23 - Prob. 3CSL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Respiratory System; Author: Amoeba Sisters;https://www.youtube.com/watch?v=v_j-LD2YEqg;License: Standard youtube license