Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 23, Problem 8RQ
In 2016, scientists published the genome of Monoceiconionoides, and demonstrated that this organism has no detectable mitochondrial genes. However, its genome was arranged in linear chromosomes wrapped around histones which are contained within the nucleus. Monoceiconionoides is therefore a(n).
- Bacteria
- Archea
- Eukaryote
- Endosymbiont
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The antibiotic kanamycin binds to the small ribosomal subunit of bacteria and interferes with protein synthesis, and the diphtheria toxin binds to the eukaryotic elongation factor EF2 and prevents translocation of the ribosome during protein synthesis. Suppose that an archaeobacterial infection is detected in a person. Could kanamycin and diphtheria toxin be
used for treatment of the infection? Why?
Enumerate examples and the molecular basis behind these diseases.
give what is ask
Please answer fast
Chapter 23 Solutions
Biology 2e
Ch. 23 - Figure 23.5 What evidence is there that...Ch. 23 - Figure 23.25 Which of the following statements...Ch. 23 - Figure 23.28 Which of the following statements...Ch. 23 - What event is thought to have contributed to the...Ch. 23 - Which characteristic is shared by prokaryotes and...Ch. 23 - Mitochondria most likely evolved by ___________ ....Ch. 23 - Which of these protists is believed to have...Ch. 23 - In 2016, scientists published the genome of...Ch. 23 - Which of the following observations about a...Ch. 23 - Protists that have a pellicle are surrounded by...
Ch. 23 - Piotists with the capabilities to perform...Ch. 23 - Which of these locomotor organs would likely be...Ch. 23 - Alternation of generations describes which of the...Ch. 23 - The amoeba E. histolytica is a pathogen that forms...Ch. 23 - Which protist group exhibits mitochondrial...Ch. 23 - Conjugation between two Paramecia produces total...Ch. 23 - What is the function of the raphe in diatoms?...Ch. 23 - What genus of piotists appears to contradict the...Ch. 23 - A marine biologist analyzing water samples notices...Ch. 23 - An example of carbon fixation is photosynthesis...Ch. 23 - Which parasitic protist evades the host immune...Ch. 23 - Which of the following is not a way that piotists...Ch. 23 - Describe the hypothesized steps in the origin of...Ch. 23 - Some aspects of eukaryotes are more similar to...Ch. 23 - Explain in your own words why sexual reproduction...Ch. 23 - Giaidia iamblia is a cyst-forming protist parasite...Ch. 23 - Explain how the definition of protists ensures...Ch. 23 - The chllorophyte (green algae) genera Ulva and...Ch. 23 - Why might a light-sensing eyespot be ineffective...Ch. 23 - Opisthokonta includes animals and fungi, as well...Ch. 23 - Describe two ways in which paramecium differs from...Ch. 23 - How does killing Anopheles mosquitoes affect the...Ch. 23 - Without treatment, why dees African sleeping...Ch. 23 - Describe how increasing stress to the ocean would...
Additional Science Textbook Solutions
Find more solutions based on key concepts
5. A 65 kg gymnast wedges himself between two closely spaced vertical walls by pressing his hands and feet ag...
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
MAKE CONNECTIONS Review the description of meiosis (see Figure 10.8) and Mendels laws of segregation and indepe...
Campbell Biology in Focus (2nd Edition)
5. When the phenotype of heterozygotes is intermediate between the phenotypes of the two homozygotes, this patt...
Biology: Life on Earth (11th Edition)
4. How do gross anatomy and microscopic anatomy differ?
Human Anatomy & Physiology (2nd Edition)
8. Studies of DNA support which of the following?
a. Members of the group called australopiths were the first t...
Campbell Biology: Concepts & Connections (9th Edition)
Why is an endospore called a resting structure? Of what advantage is an endospore to a bacterial cell?
Microbiology: An Introduction
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The largest genome size yet to be reported for any eukaryotic cell (with over 670 billion base pairs) is found in which of the following organisms? the archaeobacterium Nanoarchaeum equitans the protozoan Amoeba dubia the myxobacterium Sorangium cellulosum the human Homo sapiens .the eubacterium Escherichia coliarrow_forwardRickettsia bacteria always lives as parasites inside eukaryotic cells, ad their genomes are much smaller then those of free living bacteria. Organisms that live only as parasites often have reduced genomes compared to the free living relatives. How could a parasitic lyfestyle contribute to a reduction in genome size?arrow_forwardThe most interesting bacterial group according to Dr. Bragg would be: The Deltaproteobacteria The Firmicutes O The Gammaproteobacteria O The Cyanobacteria All of the following are true statements about events that occur in the apicomplexan life cycle EXCEPT: All of these statements are true. O the sporozoite is the motile infective stage often two completely different organisms host different stages of the life cycle the life cycles include both sexual and asexual stagesarrow_forward
- The endosymbiotic hypothesis for the origin of chloroplasts from gram-negative prokaryotes is supported by all of the following lines of evidence except: the presence of enzymes for the light-dependent and the dark reactions of photosynthesis the presence of circular DNA resembling that of photosynthetic eubacteria the presence of mRNA, tRNA, and rRNA similar to that of the cyanobacteria their use of mitosis rather than binary fission during cell division the presence of 70s ribosomes, consisting of 30s and 50s ribosomal subunitsarrow_forwardDescribe the cyanobacteria in terms of: nature of nucleus cell wall composition cytoplasmic organelles flagella photosynthetic pigments carbohydrate reserve reproduction g.1 unicellular/colonial forms _ g.2 filamentous formsarrow_forwardThe Archaea is similar to the Eukarya in the following characteristic except? initiator 1RNA (protein synthesis) O 16S FRNA nucleotide sequence sensitivity to antibiotics types of RNA polymerase The Archaea differ from the Eubacteria in the following characteristic except: * O initiator tRNA (protein synthesis) origin of DNA replication sensitivity to antibiotics types of RNA polymerasearrow_forward
- 19arrow_forwardMicrobiologists debate the use of biochemical similarities and cell features as a way of determining the taxonomic relationships among prokaryotes. Explain why some microbiologists believe these similarities and differences are a powerful taxonomic indicator, whereas others think they are not very useful for that purpose.arrow_forwardThe figure below shows the life cycle of the fungus Neurospora. The adult stage of the Neurospora is a multicellular haploid. Neurospora has an arginine amino acid synthesis pathway shown below. Suppose I have a Neurospora strain that has a mutation such that it will not grow unless I supplement the media (food) with arginine (but not with citrulline or ornithine). What gene is mutated? Explain your reasoning.arrow_forward
- Which of the following prokaryotes has a relatively large surface-to-volume ratio for rapid gas exchange, despite having one of the largest cytoplasmic volumes of any known eubacterial cell? the archaeobacterium Halobacterium halobium the archaeobacterium Nanoarchaeum equitans the eubacterium Rhodopseudomonas viridis the eubacterium Epulopiscium fishelsoni the eubacterium Escherichia coliarrow_forward--ina Category 1: Cell Structure and Function rartlu into a Prokaryotic Pizza and a Cut out the s Eukaryotic I Reporting Category 2: Mechanisms of Genetics Instructions: Answer the questions shown below on the following answer sheet. SATGAGGGCGAGCGGCGCCCACGTTTTAGGGTGA 3'TACTCCCGCTCGCCGCGGGTGCAAAATCCCACTS 1. What is the name of |||| molecule? Celle whethe is a large cell's gen thin laye The nucl Eukary Prokar tain nu meanin meani otic ce Prol simp 2. What cellular process is being shown by the arrow? 3. Where in the cell does this process take place? S'AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA³ MRNA 4. RNA should be in a 5' to 3'direction. Based on this 5. What cellular process is being shown by the arrow (MRNA to amino Information which DNA strand will be your template strand to make the acida MRNA? 6. Where in the cell does this process take place? Amino acids exce Use the codon chart to determine the correct amino acids. (you may abbreviate) ger 7. How many MRNA bases ot make up a codon?…arrow_forwardAccording to Philip Bell’s viral eukaryogenesis hypothesis, genes for DNA replication, RNA transcription, protein translation, and histone proteins were all provided by: an endosymbiotic gram-negative eubacterium an endosymbiotic archaeobacterium a gram-positive eubacterial host cell a double-stranded DNA virus an archaeobacterial host cellarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Bacterial Structure and Functions; Author: Osmosis;https://www.youtube.com/watch?v=b15Hy3jCPDs;License: Standard youtube license