
To label: The somatosensory receptors in Figure 23.1 (a).
Introduction: A cell or a group of cells that is specialized in detecting the changes in the environment and triggers the impulses in the sensory nervous system is referred to as the somatosensory receptors. The somatosensory receptors are categorized into five types, namely the thermoreceptors, mechanoreceptors, pain receptors, proprioceptors, and chemoreceptors.

Answer to Problem 1.1BGL
Pictorial representation:
Explanation of Solution
1. Type I cutaneous mechanoreceptor: They are free nerve endings located in the skin and is associated with the Merkel cells in the stratum basale layer of the epidermis. The stimuli of these receptors are touch and pressure.
2. Corpuscle of touch: They are encapsulated nerve endings situated in the dermal papillae of the hairless skin. Touch and pressure are the stimuli of these receptors.
3. Type II cutaneous mechanoreceptor: They are encapsulated nerve endings that are situated on the tendons, ligaments, and dermis. Stretching of the limbs and digits are the stimuli of these receptors.
4. Root hair plexus: They are the free nerve endings that surround the follicles of hair. The stimuli of root hair plexus touch the hair.
5. Lamellated corpuscle: They are encapsulated nerve endings situated in the subcutaneous and submucosal muscles, tissues, joints, and tendons. Touch and pressure are the stimuli of these receptors.
To label: The somatosensory receptors in Figure 23.1 (b).

Answer to Problem 1.1BGL
Pictorial representation:
Explanation of Solution
6. Muscle spindle: They are encapsulated nerve endings located within most of the skeletal muscles. These receptors respond to the changes in the length of the muscles.
7. Tendon organ: They are encapsulated nerve endings situated at the junction of the muscles and tendons. These receptors respond to the changes in the movement and position of the joints.
Want to see more full solutions like this?
Chapter 23 Solutions
Laboratory Manual for Anatomy and Physiology, 6e Loose-Leaf Print Companion with WileyPLUS Blackboard Card Set
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





